text2genome

About us

Related Links

Press Coverage

PubMed: 18799476    PubMedCentral: PMC2581427

Identification of Arx transcriptional targets in the developing basal forebrain.

Fulp CT, Cho G, Marsh ED, Nasrallah IM, Labosky PA, Golden JA
Human molecular genetics, 3740 , 2008

Abstract:

Mutations in the aristaless-related homeobox (ARX) gene are associated with multiple neurologic disorders in humans. Studies in mice indicate Arx plays a role in neuronal progenitor proliferation and development of the cerebral cortex, thalamus, hippocampus, striatum, and olfactory bulbs. Specific defects associated with Arx loss of function include abnormal interneuron migration and subtype differentiation. How disruptions in ARX result in human disease and how loss of Arx in mice results in these phenotypes remains poorly understood. To gain insight into the biological functions of Arx, we performed a genome-wide expression screen to identify transcriptional changes within the subpallium in the absence of Arx. We have identified 84 genes whose expression was dysregulated in the absence of Arx. This population was enriched in genes involved in cell migration, axonal guidance, neurogenesis, and regulation of transcription and includes genes implicated in autism, epilepsy, and mental retardation; all features recognized in patients with ARX mutations. Additionally, we found Arx directly repressed three of the identified transcription factors: Lmo1, Ebf3 and Shox2. To further understand how the identified genes are involved in neural development, we used gene set enrichment algorithms to compare the Arx gene regulatory network (GRN) to the Dlx1/2 GRN and interneuron transcriptome. These analyses identified a subset of genes in the Arx GRN that are shared with that of the Dlx1/2 GRN and that are enriched in the interneuron transcriptome. These data indicate Arx plays multiple roles in forebrain development, both dependent and independent of Dlx1/2, and thus provides further insights into the understanding of the mechanisms underlying the pathology of mental retardation and epilepsy phenotypes resulting from ARX mutations.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:11878/Arx
EntrezGene:12307/Calb1
EntrezGene:12767/Cxcr4
EntrezGene:13591/Ebf1
EntrezGene:14472/Gbx2
EntrezGene:15114/Hap1
EntrezGene:17260/Mef2c
EntrezGene:17311/Kitl
EntrezGene:17984/Ndn
EntrezGene:20429/Shox2
EntrezGene:20604/Sst
EntrezGene:20681/Sox8
EntrezGene:21664/Phlda1
EntrezGene:22255/Uncx
EntrezGene:27385/Magel2
EntrezGene:67405/Nts
EntrezGene:108655/Foxp1
EntrezGene:109594/Lmo1
EntrezGene:207667/Lbxcor1
EntrezGene:218820/Zfp503
EntrezGene:270097/Vat1l
Genes found in fulltext (GNAT)
EntrezGene:109594/Lmo1
EntrezGene:12307/Calb1
EntrezGene:13390/Dlx1
EntrezGene:13392/Dlx2
EntrezGene:14472/Gbx2
EntrezGene:170302/ARX
EntrezGene:17311/Kitl
EntrezGene:1745/DLX1
EntrezGene:1749/DLX5
EntrezGene:20429/Shox2
EntrezGene:22255/Uncx
EntrezGene:2571/GAD1
EntrezGene:2572/GAD2
EntrezGene:2637/GBX2
EntrezGene:27086/FOXP1
EntrezGene:2936/GSR
EntrezGene:31/ACACA
EntrezGene:4004/LMO1
EntrezGene:4254/KITLG
EntrezGene:4692/NDN
EntrezGene:5080/PAX6
EntrezGene:51366/UBR5
EntrezGene:5456/POU3F4
EntrezGene:6474/SHOX2
EntrezGene:67405/Nts
EntrezGene:793/CALB1

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

No genes found

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
7, 8, 28, 29 chr3:66786225-66786328
9, 10, 22, 23, 26, 27 chr7:116318846-116319016
0, 1 chrX:90533156-90535654
13 chr6:125115600-125115624
4, 5 chrY:1917607-1920436
31 chr7:69524512-69524547
13 chr12:5597479-5597862
13 chr18:55998656-55998680
11, 12, 16, 17, 18, 19, 20, 21 chr7:144507440-144507660

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2581427.pdf TGGAGCGGGGACAGGGGTGAGGTT
1 PMC2581427.pdf GGCCGGTCTCTTTCTTTCTACTCA
2 PMC2581427.pdf CAATGCTGTTTCACTGGTTATG
3 PMC2581427.pdf CATTGCCCCTGTTTCACTATC
4 PMC2581427.pdf CAGAAATGAACTACTGCATCCC
5 PMC2581427.pdf AACTTGTGCCTCTCACCACG
6 PMC2581427.pdf AAGAACCCCAAAAGCTAAG
7 PMC2581427.pdf TCCAGTTCCCCAGTGTTTTACTAAGT
8 PMC2581427.pdf GCTCTTGGCCATTAATCCAGGATT
9 PMC2581427.pdf TAAGCTAATGGCGGGCACCT
10 PMC2581427.pdf CTCGCTCTCACCAGAGTGCA
11 PMC2581427.pdf CCGTAATGGATTTTGAGATGGGA
12 PMC2581427.pdf TGAATTGGTGGTGTGTGTGC
13 PMC2581427.pdf TGGAACAGGGAGGAGCAGAGAGCA
14 PMC2581427.pdf cgGAATTCgaGAGGGCGGGGAGCTGTCGCC
15 PMC2581427.pdf ccgCTCGAGTTACGAATCAAGCGCAGGGTGATGCG
16 PMC2581427.pdf GCGATTTTCCCGATTAATTAAAATATTAACGCA
17 PMC2581427.pdf GTGCGTTAATATTTTAATTAATCGGGAAAATCG
18 PMC2581427.pdf GCGATTTTCCCGATTCCTTAAAATATTAACGCA
19 PMC2581427.pdf GTGCGTTAATATTTTAAGGAATCGGGAAAATCG
20 PMC2581427.pdf GCGATCCTCCCGATTAATTAAAATATTAACGCA
21 PMC2581427.pdf GTGCGTTAATATTTTAATTAATCGGGAGGATCG
22 PMC2581427.pdf GTAATGAATTGATTTAATTAACAGGGGAGTCTGA
23 PMC2581427.pdf GTCAGACTCCCCTGTTAATTAAATCAATTCATTA
24 PMC2581427.pdf GTAATGAATTGATTTCCTTAACAGGGGAGTCTGA
25 PMC2581427.pdf GTCAGACTCCCCTGTTAAGGAAATCAATTCATTA
26 PMC2581427.pdf GTAATGAACCGATTTAATTAACAGGGGAGTCTGA
27 PMC2581427.pdf GTCAGACTCCCCTGTTAATTAAATCGGTTCATTA
28 PMC2581427.pdf GCAAAATCCACGCTTAATTAAATTAATTAGGGA
29 PMC2581427.pdf GTCCCTAATTAATTTAATTAAGCGTGGATTTTG
30 PMC2581427.S2.pdf CTCCGTCTTGGAAAATGACCGAATGCAAGAAACATCACATC
31 PMC2581427.S2.pdf ATGGCTCCATCAGGAGAACCTGGCCCTTCTCTGGCCGCTAACCTCCGAGTACACAAATGAATAGCA
32 PMC2581427.S2.pdf AAACGCAAACACGAGAAGAAATGTTAGGTCCCGGAAAGA
33 PMC2581427.S2.pdf TGCATGGAAGAAAACGCACCGGCTTACATTTAGGCTGCTCTC
34 PMC2581427.S2.pdf CAGACACCTCCTCGGCACATCCTGGGGTCTGACAACTGG
35 PMC2581427.S2.pdf GATGGTGCTGGACAAGGAGGACCTGGGATTCAAAGGTGCC
Display recognized sequences in FASTA format