text2genome

About us

Related Links

Press Coverage

PubMed: 6330691    PubMedCentral: PMC318890

Are there major developmentally regulated H4 gene classes in Xenopus?

Woodland HR, Warmington JR, Ballantine JE, Turner PC
Nucleic acids research, 4939 , 1984

Abstract:

Primer extension analysis has been used to study the principal H4 mRNAs present at different developmental stages and in several adult tissues of Xenopus borealis and X. laevis. In X. borealis a single sequence class predominates in oocytes, tadpoles and cultured fibroblasts. There is also a polymorphic minor type which shows no developmental regulation. The primer extension bands obtained from adult liver and kidney RNA appear to be the same as ovary and therefore these tissues almost certainly contain the same major H4 mRNA species. This is confirmed by S1 mapping of the 3' end of the mRNA. Thus for H4 genes in X. borealis there is no evidence of the kind of switches in histone gene expression seen in sea urchins or certain protostomes. The situation in X. laevis is complicated by considerably higher gene variability both within and between individuals. Nevertheless, in this species, as in X. borealis, there seems to be no major developmental switch in the regulation of H4 gene expression, a conclusion that also holds for an H1C and an H3 gene.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:29969/MDFIC
EntrezGene:31/ACACA
EntrezGene:83881/MIXL1

Best predicted genome from sequences: Gallus gallus

Best predicted genes based on DNA sequences found in paper:

No genes found

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
16 chr1:49951688-49997969

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC318890.txt TCACATtGTCGAGAGCTAGCTTCGAGATTTAAGTCATGCCATtGTCGAGAGCTAGCTTCGAGATTTAAGTCATGATtGTCGAGAGCTAGCTTCGAGATTTAAGTCATGCATtGTCGAGAGCTAGCTTCGAGATTTAAGTCATGTtGTCGAGAGCTAGCTTCGAGATTTAAGTCATG
1 PMC318890.txt ATGTCTGGATCTGGATCTGGATCTGGATCTGGATCTGGAAGAGGCAAGGAGAGGCAAGGAGAGGCAAGGAGAGGCAAGGAGAGGCAAGGCGCGGCAAAG
2 PMC318890.txt TCACATAGTCGAGAGCTAGCTTCGAGATTTAAGTCATGTCTGTAGTCGAGAGCTAGCTTTGAGATTTAAGTCATGTCTATAGTCGAGAGCTAGCTTCGAGATTTAAGTCATGTCTAGTCGAGAGCTAGCTTCGAGATTTAAGTCATGTCTCGACATAGTCGAGAGCTAGCTTTGAGATTTAAGTCATGTCTTGGAAGAGGCAAGGGGAAGAGGCAAGGGGAAGAGGCAAGGGGAAGAGGCAAGGGGAAGAGGCAAGG
3 PMC318890.txt CGCTCGCTTGCTATCATGTCTGGATTCGCTTTAGGTCATGTCTGGAGCATCGCTTCTCTTGAATCATGTCTGGACCGGCGGCGCTTCTCTTGATATCATGTCTGGACGGCGGCGCTTGCTATCATGTCTGGCGCGGCAAAGCGCGGCAAAGCGCGGCAAAGCGCGGCGCGGCAAAG
4 PMC318890.txt CGCTCCTGCTATCATGTCTGGACGCGGCAAAG
5 PMC318890.txt TCACATAGTCGAGAGCTAGCTTCGAGATTTAAGTCATGTCTGGAAGAGGCAAGG
6 PMC318890.txt CTCTCTCGATAAACGCTAGTGAGTGGAATCAATTTTTCTCTCGATAGCAACCTTTGCGCGTAGAATC
7 PMC318890.txt ATAGAACCTTTGCGCGTAATCTTCGATAACGCCATTAGTGGTGAAATC
8 PMC318890.txt CACGTTCGTACCAGAACTGA
9 PMC318890.txt GATCCCTTTAGCGGTCCGGGCCCCGTGGTCGTTGTGATCAAGCACGACAGGAATTTGTGATCAAGCATCGGAGGAAATGTCTATGTCTATGTCTATGTCTATGTCTATGTCTGGAAGAGGCAAGGGGAAGAGGCAAGGGGAAGAGGCAAGGGGAAGAGGCAAGGGGAAGAGGCAAGGGGAAGAGGCAAGGATGTCTGGAAGAGGCAAGGATGTCTGGAAGAGGCAAGGATGTCTGGACGCGGCAAAGATGTCCGGACGCGGCAAAGATGTCTGGACGCGGCAAAGATGTCTGGACGCGGCAAAG
10 PMC318890.txt ATAGCAACCTTTGTGCGTAAATCATGTCTGGAAGAGGCAAGG
11 PMC318890.txt GCAATCTTTGAGCGTAAATC
12 PMC318890.txt GTGATCAAGCACTGACAGGAA
13 PMC318890.txt CCAAGCACGACAGGAAATGTCTGGACGCGGCAAAG
14 PMC318890.txt GTGATCCAAGCCCGACTGGAAA
15 PMC318890.txt GAGAACGTTATCCGGGACGCGGTCACCTACTCTCTCCATTAGTCT
16 PMC318890.txt ACCGAGCACGCCAAGAGGAAGACCGTTA
Display recognized sequences in FASTA format