text2genome

About us

Related Links

Press Coverage

PubMed: 18431502    PubMedCentral: PMC2292257

Lhx2 expression promotes self-renewal of a distinct multipotential hematopoietic progenitor cell in embryonic stem cell-derived embryoid bodies.

Dahl L, Richter K, Hägglund AC, Carlsson L
PloS one, , 2008

Abstract:

The molecular mechanisms regulating the expansion of the hematopoietic system including hematopoietic stem cells (HSCs) in the fetal liver during embryonic development are largely unknown. The LIM-homeobox gene Lhx2 is a candidate regulator of fetal hematopoiesis since it is expressed in the fetal liver and Lhx2(-/-) mice die in utero due to severe anemia. Moreover, expression of Lhx2 in embryonic stem (ES) cell-derived embryoid bodies (EBs) can lead to the generation of HSC-like cell lines. To further define the role of this transcription factor in hematopoietic regulation, we generated ES cell lines that enabled tet-inducible expression of Lhx2. Using this approach we observed that Lhx2 expression synergises with specific signalling pathways, resulting in increased frequency of colony forming cells in developing EB cells. The increase in growth factor-responsive progenitor cells directly correlates to the efficiency in generating HSC-like cell lines, suggesting that Lhx2 expression induce self-renewal of a distinct multipotential hematopoietic progenitor cell in EBs. Signalling via the c-kit tyrosine kinase receptor and the gp130 signal transducer by IL-6 is necessary and sufficient for the Lhx2 induced self-renewal. While inducing self-renewal of multipotential progenitor cells, expression of Lhx2 inhibited proliferation of primitive erythroid precursor cells and interfered with early ES cell commitment, indicating striking lineage specificity of this effect.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:16870/Lhx2
Genes found in fulltext (GNAT)
EntrezGene:1003/CDH5
EntrezGene:1046/CDX4
EntrezGene:10763/NES
EntrezGene:1270/CNTF
EntrezGene:1489/CTF1
EntrezGene:16590/Kit
EntrezGene:16870/Lhx2
EntrezGene:17311/Kitl
EntrezGene:25/ABL1
EntrezGene:2626/GATA4
EntrezGene:3569/IL6
EntrezGene:3572/IL6ST
EntrezGene:3589/IL11
EntrezGene:3674/ITGA2B
EntrezGene:3791/KDR
EntrezGene:3815/KIT
EntrezGene:3975/LHX1
EntrezGene:3976/LIF
EntrezGene:4086/SMAD1
EntrezGene:4254/KITLG
EntrezGene:4851/NOTCH1
EntrezGene:5008/OSM
EntrezGene:5015/OTX2
EntrezGene:5080/PAX6
EntrezGene:6899/TBX1
EntrezGene:7422/VEGFA
EntrezGene:79923/NANOGP8
EntrezGene:9355/LHX2
EntrezGene:947/CD34
EntrezGene:960/CD44

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Gapdh ENSMUSG00000057666 0,1
Tbp ENSMUSG00000014767 2,3
Cd34 ENSMUSG00000016494 4,5
Hbb-bh1 ENSMUSG00000052217 9,10
Hbb-b1 ENSMUSG00000073940 11,12
Kitl ENSMUSG00000019966 14,15
Cd44 ENSMUSG00000005087 17,18
Il6 ENSMUSG00000025746 19,20
Il6st ENSMUSG00000021756 21,22
Epor ENSMUSG00000006235 23,24
Otx2 ENSMUSG00000021848 25,26
Gata4 ENSMUSG00000021944 30,29
Nfatc1 ENSMUSG00000033016 34,35
Tbx5 ENSMUSG00000018263 36,37
Nes ENSMUSG00000004891 38,39
Foxa2 ENSMUSG00000037025 41,40
Sox17 ENSMUSG00000025902 42,43
Nanog ENSMUSG00000012396 45,46
Hprt1 ENSMUSG00000025630 49,50

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chrX:148380601-148380674
0, 1 chr7:96756897-96756970
0, 1 chr9:75541695-75541768
3 chr17:15644338-15644363
0, 1 chr8:60029791-60029864
0, 1 chr15:93027720-93027793
47, 48 chr2:38215480-38224587
34 chr18:80878991-80879011
0, 1 chr6:128152400-128152557
0, 1 chr2:151200474-151200691
0, 1 chr13:17913478-17913551
44 chr15:93510182-93510202
28 chr15:74578165-74578183
25 chr14:49287104-49287126
0, 1 chr8:47340260-47340333
27 chr2:105536428-105536452
42, 43 chr1:4485994-4486428
0, 1 chr1:13776199-13776272
0, 1 chr4:57384060-57384133
9, 10, 11, 12 chr7:110961261-110991599
0, 1 chr13:99172284-99172357
0, 1 chr6:83824608-83824681
0, 1 chr2:28789363-28789436
0, 1 NT_166349:397114-397187
0, 1 chr19:40287560-40287633
0, 1 chr3:121933348-121933421
0, 1 chr2:104132423-104132496
0, 1 chr7:59002759-59002832
0, 1 chr2:11330892-11330965
0, 1 chr6:125112395-125112552
0, 1 chr14:49028993-49029066
28 chr1:161224128-161224146
18 chr2:102664430-102664455
4 chr1:196785360-196785382
44 chr8:44386009-44386029
0, 1 chr1:15259115-15259188
0, 1 chr13:49900548-49900621
0, 1 chr5:106291955-106292028
0, 1 chr6:91379569-91379642
41 chr2:147871562-147871581
0, 1 chr15:4835812-4835885
0, 1 chr15:12505336-12505409
49, 50 chrX:50373284-50374371
0, 1 chr10:33528535-33528608
0, 1 chr11:20235250-20235323
13 chr5:76348905-76348927
46 chrX:87129085-87129106
0, 1 chr11:63126047-63126120
46 chr12:62559979-62560000
45 chr6:122662696-122662720
0, 1 chr1:188785083-188785156
0, 1 chr17:14846753-14846826
0, 1 chr11:26687325-26687398
33 chr17:26978044-26978065
0, 1 chr3:142626267-142626340
0, 1 chr8:77929652-77929725
0, 1 chr8:94212503-94212576
23, 24 chr9:21766275-21766684
30 chr14:63823499-63823520
0, 1 chr4:91518594-91518667
0, 1 chr1:102179141-102179214
0, 1 chr12:5596658-5596731
0, 1 chr2:43374152-43374225
28 chr17:35647525-35647543
0, 1 chr14:103769917-103769990
0, 1 chr8:95240061-95240134
0, 1 chr5:96291425-96291498
37 chr5:120295029-120295051
0, 1 chr1:12556158-12556231
0, 1 chr13:98228339-98228412
0, 1 chr17:61920573-61920646
0, 1 chr3:139313035-139313108
21, 22 chr13:113291380-113293049
38, 39 chr3:87779427-87779560
6 chr11:102321452-102321472
8 chr6:88154599-88154622
0, 1 chr11:4464329-4464389
31 chr8:106660616-106660643
0, 1 chr19:46748998-46749071
19, 20 chr5:30340042-30341393

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2292257.pdf CGTGTTCCTACCCCCAATGT
1 PMC2292257.pdf TGTCATCATACTTGGCAGGTTTCT
2 PMC2292257.pdf GAATTGTACCGCAGCTTCAAAA
3 PMC2292257.pdf AGTGCAATGGTCTTTAGGTCAAGTT
4 PMC2292257.pdf CTTGGGCACCACTGGTTATTTC
5 PMC2292257.pdf GGTCTTCACCCAGCCTTTCTC
6 PMC2292257.pdf GCTCCGGCTCACAGCTACTG
7 PMC2292257.pdf ATCATTGGCTGCTTCAATCTTCAGata
8 PMC2292257.pdf TCGTCTGACAATTTGCACAACAG
9 PMC2292257.pdf AGGCAGCTATCACAAGCATCTG
10 PMC2292257.pdf AACTTGTCAAAGAATCTCTGAGTCCAT
11 PMC2292257.pdf GTGAGCTCCACTGTGACAAGCT
12 PMC2292257.pdf GGTGGCCCAGCACAATCACGATC
13 PMC2292257.pdf ACTGCAGTGATTGCCATGTTCT
14 PMC2292257.pdf GAAAACGCACCGAAGAATATAAAAG
15 PMC2292257.pdf TCTAGTTTCTGGCCTCTTCGGAc
16 PMC2292257.pdf AAGTTTGGCAGGATCTCTAACAAAC
17 PMC2292257.pdf TCCGAATTAGCTGGACACTCAA
18 PMC2292257.pdf TCTCCTCATAGGACCAGAAGTTGTG
19 PMC2292257.pdf ACAAGTCGGAGGCTTAATTACACAT
20 PMC2292257.pdf AATCAGAATTGCCATTGCACAA
21 PMC2292257.pdf TGCTGGGCGTCTTGTTCTG
22 PMC2292257.pdf ATATGACTCTTGGAAGGATCAGGAA
23 PMC2292257.pdf GGATGGACTTCAACTACAGCTTCTC
24 PMC2292257.pdf CCTGGTGCAGGCTACATGACT
25 PMC2292257.pdf GAGCTCAGTCGCCACCTCTACT
26 PMC2292257.pdf CCGCATTGGACGTTAGAAAAG
27 PMC2292257.pdf AACTGACACTCCAGGTGAAATGAG
28 PMC2292257.pdf TACCTCCCTTGCCTTGGCGATA
29 PMC2292257.pdf CACCCCAATCTCGTAGATATGTTTG
30 PMC2292257.pdf GGTAGTGTCCCGTCCCATCTC
31 PMC2292257.pdf GTTATAGATGTTTCCCTGCTTGGTTAT
32 PMC2292257.pdf GCATTTCGCACACCTGGAT
33 PMC2292257.pdf CCAAGTGCTCTCCTGCTTTCC
34 PMC2292257.pdf CCATACGAGCTTCGGATCGA
35 PMC2292257.pdf AGTAACCGTGTAGCTGCACAATG
36 PMC2292257.pdf CGTTTGGACACATTATCCTGAACT
37 PMC2292257.pdf TGAACCGAACCCATTATTTTCG
38 PMC2292257.pdf CTCTTCCCCCTTGCCTAATACC
39 PMC2292257.pdf TTTAGGATAGGGAGCCTCAGACAT
40 PMC2292257.pdf GGCCAGCGAGTTAAAGTATGCT
41 PMC2292257.pdf CTCGGGCTCCGCGTAGTAG
42 PMC2292257.pdf CCCAACACTCCTCCCAAAGTATC
43 PMC2292257.pdf TTCCCTGTCTTGGTTGATTTCTC
44 PMC2292257.pdf TCACTGTGCTGCCTCCAAGT
45 PMC2292257.pdf AAACCAGTGGTTGAAGACTAGCAA
46 PMC2292257.pdf TGCAATGGATGCTGGGATACT
47 PMC2292257.pdf AAAAGACAAAGCGCATGCGGC
48 PMC2292257.pdf CAGGCACAGAAGTTAAGACTG
49 PMC2292257.pdf CACAGGACTAGAACACCTGC
50 PMC2292257.pdf GCTGGTGAAAAGGACCTCT
Display recognized sequences in FASTA format