text2genome

About us

Related Links

Press Coverage

PubMed: 15905474    PubMedCentral: PMC1131934

HP1 modulates the transcription of cell-cycle regulators in Drosophila melanogaster.

De Lucia F, Ni JQ, Vaillant C, Sun FL
Nucleic acids research, 2852 , 2005

Abstract:

Heterochromatin protein 1 (HP1) was originally described as a non-histone chromosomal protein and is required for transcriptional gene silencing and the formation of heterochromatin. Although it is localized primarily at pericentric heterochromatin, a scattered distribution over a large number of euchromatic loci is also evident. Here, we provide evidence that Drosophila HP1 is essential for the maintenance of active transcription of euchromatic genes functionally involved in cell-cycle progression, including those required for DNA replication and mitosis. Depletion of HP1 in proliferating embryonic cells caused aberrant progression of the cell cycle at S phase and G2/M phase, linked to aberrant chromosome segregation, cytokinesis, and an increase in apoptosis. The chromosomal distribution of Aurora B, and the level of phosphorylation of histone H3 serine 10 were also altered in the absence of HP1. Using chromatin immunoprecipitation analysis, we further demonstrate that the promoters of a number of cell-cycle regulator genes are bound to HP1, supporting a direct role for HP1 in their active transcription. Overall, our data suggest that HP1 is essential for the maintenance of cell-cycle progression and the transcription of cell-cycle regulatory genes. The results also support the view that HP1 is a positive regulator of transcription in euchromatin.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:31052/CDC45L
EntrezGene:31449/Mcm3
EntrezGene:31603/Mcm6
EntrezGene:32763/CG8142
EntrezGene:34119/Su(var)205
EntrezGene:34328/Dref
EntrezGene:34423/RfC3
EntrezGene:34504/ial
EntrezGene:34792/tam
EntrezGene:35522/BubR1
EntrezGene:35649/Incenp
EntrezGene:35790/CG8709
EntrezGene:37970/Orc4
EntrezGene:38135/Klp61F
EntrezGene:39014/Mcm7
EntrezGene:40607/Gnf1
EntrezGene:40973/Mcm2
EntrezGene:41296/Mcm5
EntrezGene:41836/Caf1
EntrezGene:41952/msps
EntrezGene:42758/DNApol-epsilon
EntrezGene:42946/asp
EntrezGene:42971/CycB3
EntrezGene:43490/Bub3
EntrezGene:44915/DNApol-alpha60
EntrezGene:3772064/DNApol-gamma35
Species found in fulltext (Linnaeus)
Drosophila melanogaster
Saccharomyces cerevisiae
Homo sapiens
Mus musculus
Oryctolagus cuniculus
Bos taurus
Armoracia rusticana
Alces alces
Schizosaccharomyces pombe
Genes found in fulltext (GNAT)
EntrezGene:10273/STUB1
EntrezGene:12419/Cbx5
EntrezGene:34119/Su(var)205
EntrezGene:3619/INCENP
EntrezGene:4171/MCM2
EntrezGene:4172/MCM3
EntrezGene:4174/MCM5
EntrezGene:4175/MCM6
EntrezGene:4176/MCM7
EntrezGene:5000/ORC4L
EntrezGene:699/BUB1
EntrezGene:8318/CDC45L
EntrezGene:9184/BUB3
EntrezGene:9212/AURKB

Best predicted genome from sequences: Drosophila melanogaster

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Incenp FBgn0033156 0,1
ial FBgn0024227 2,31
asp FBgn0000140 3,4
Mcm3 FBgn0024332 5,6,21
Mcm5 FBgn0017577 7,8,23,24
Mcm7 FBgn0020633 9,10
Act5C FBgn0000042 13,14,30
tam FBgn0004406 27,28

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
7, 8, 23, 24 3R:6614249-6614949
0, 1 2R:3166233-3166841
9, 10, 25, 26 3L:8884850-8886459
3, 4 3R:20580165-20580724
27, 28 2L:13827133-13827793
2, 31, 32 2L:10857431-10858082
5, 6, 21, 22 chrX:5217938-5218589
11 chrX:924340-924360
14 3L:21979808-21979827
13, 30 chrX:5797220-5797343

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1131934.S2.pdf ATGGAGGACATCTTGGGCG
1 PMC1131934.S2.pdf CCGCATCTTACGGTTGAGTG
2 PMC1131934.S2.pdf TTCGCCACTTGGTAGGTGTACT
3 PMC1131934.S2.pdf ATGGAGCTAGTGTGGAGCC
4 PMC1131934.S2.pdf GGTGAGAGGTGTGAATCGC
5 PMC1131934.S2.pdf GAGGGGGAGCAGTTCATCA
6 PMC1131934.S2.pdf AAACCGTATTCGGTCTCCAG
7 PMC1131934.S2.pdf TGGAAGGCTTCGACGATGC
8 PMC1131934.S2.pdf CAGGACAGGCATTGGATAGA
9 PMC1131934.S2.pdf ATCTGTATCAACAAGAACGAC
10 PMC1131934.S2.pdf GCTATCGAAATGGTCTGCTG
11 PMC1131934.S2.pdf ATGTTTGTCCAGGATCTGCG
12 PMC1131934.S2.pdf CTGAGCTTACGGCTCCTTG
13 PMC1131934.S2.pdf TGCCCATCTACGAGGGTTAT
14 PMC1131934.S2.pdf AGTACTTGCGCTCTGGCGG
15 PMC1131934.S2.pdf ATCACGGTAGAAGAGCCGCA
16 PMC1131934.S2.pdf TGTGAAGACGGATTTTCAGCTC
17 PMC1131934.S2.pdf TGTATCGTTTTTAAAAAATTGTCAG
18 PMC1131934.S2.pdf GTGGACCTGTAATATATGCTCT
19 PMC1131934.S2.pdf GTACAACCAAAGTTGACGGG
20 PMC1131934.S2.pdf TGTATCGATATTTCGCGCTTTT
21 PMC1131934.S2.pdf ATTTGCGTTTGCCTCCGAAC
22 PMC1131934.S2.pdf CAGTAGCCCCAATGCACGT
23 PMC1131934.S2.pdf TCTAGCTACCGCTTGCCCG
24 PMC1131934.S2.pdf TTGTAGAAAAAGTTCTCCTCGTT
25 PMC1131934.S2.pdf GGCTCGACGAGATTATGCC
26 PMC1131934.S2.pdf GGACAGTGGTTTGAAGCCC
27 PMC1131934.S2.pdf GCGCACAAAAATACCTAGGC
28 PMC1131934.S2.pdf CACATCGAAGACAAGTCCCT
29 PMC1131934.S2.pdf TGCCCATCTACGAGGGTTAT
30 PMC1131934.S2.pdf CGGTGGTGGTGAAAGAGTAA
31 PMC1131934.S2.pdf TCAGCATTCGAAAAAAACGCGC
32 PMC1131934.S2.pdf TCGTATCTGGAGGGAGCAGAT
Display recognized sequences in FASTA format