text2genome

About us

Related Links

Press Coverage

PubMed: 18253094    PubMedCentral: PMC2254965

The cytotoxic and stress responses of human trabecular meshwork cells treated with triamcinolone acetonide.

Wang DY, Fan BJ, Yam GY, Lam DS, Pang CP
Molecular vision, 105 , 2008

Abstract:

PURPOSE: To evaluate the cytotoxic effect of triamcinolone acetonide (TA) on cultured human trabecular meshwork (TM) cells. METHODS: TA (0.1 mg/ml, 1 mg/ml) or the vehicle (benzyl alcohol, 0.0025%, 0.025%) was added to human TM cell cultures on day 0 and collected subsequently on day 1, 3, or 5. The amount of cell proliferations with or without TA treatment was measured using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenylterazolium bromide (MTT) assay. All samples were read in triplicate (n=4 in all cases). By using real-time quantitative polymerase chain reaction (PCR), gene expression levels of c-fos, c-jun, caspase-3, c-myc, and p53 were determined after TA treatments at 0 min, 10 min, 20 min, 30 min, 50 min, 80 min, 2 h, 12 h, 24 h, and 48 h. Unpaired t-test was used to test the drug and concentration effects of TA, ANOVA was used to test the time effects of TA, and the Bonferroni test was used to correct multiple comparisons. Apoptosis of TM cells as a result of TA treatment were assessed by the terminal uridyl nick end labeling (TUNEL) assay. RESULTS: Both concentrations of TA caused a significant reduction in the number of human TM cells as early as day 1 and across five days of the treatment period. Significantly increased expressions of c-jun, c-fos, c-myc, p53, and caspase 3 were observed at different time points after both 0.1 mg/ml and 1 mg/ml TA treatment. Significantly increased apoptotic cells were observed after TA treatment for three days. CONCLUSIONS: Our results showed that TA was cytotoxic to human TM cells in culture and the presence of TA caused apoptotic cell death. It gave evidence that the underlying mechanism of TA caused ocular hypertension and may be associated with necrosis and apoptosis of the TM cells.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:10249/GLYAT
EntrezGene:183/AGT
EntrezGene:2353/FOS
EntrezGene:2597/GAPDH
EntrezGene:31/ACACA
EntrezGene:3815/KIT
EntrezGene:4350/MPG
EntrezGene:4609/MYC
EntrezGene:4858/NOVA2
EntrezGene:7157/TP53
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:836/CASP3

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
FOS ENSG00000170345 3,4
TP53 ENSG00000141510 7,8

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0 chr1:32868485-32868506
3, 4 chr14:75747486-75747943
0 chr6:166477987-166478008
0 chr22:41070225-41070246
7, 8 chr17:7579388-7579584
6 chr4:185550492-185550516
0 chr8:101563712-101563733
0 chr12:6645930-6645951
0 chr1:92581130-92581151
0 chr11:88142143-88142164
0 chr5:159378275-159378296
0 chrX:39647159-39647180
0 chr1:94767785-94767806
1 chr1:59248735-59248757
0 chr1:52173587-52173608

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2254965.pdf GAAGATGGTGATGGGATTTCc
1 PMC2254965.pdf GTGACGGACTGTTCTATGACTG
2 PMC2254965.pdf GGGGGTCGGCGTGGTGGTGATGc
3 PMC2254965.pdf AGACAGACCAACTAGAAGATGA
4 PMC2254965.pdf AGCTCTGTGGCCATGGGCCCC
5 PMC2254965.pdf TATTCTTGGGGAAATTCAAAGGAT
6 PMC2254965.pdf AAAGTAGCGTCAAAGGAAAAGGAC
7 PMC2254965.pdf TTGCCGTCCCAAGCAATGGATGA
8 PMC2254965.pdf GGGAAGGGACAGAAGATGAC
Display recognized sequences in FASTA format