text2genome

About us

Related Links

Press Coverage

PubMed: 18001476    PubMedCentral: PMC2203985

Therapeutic T cells induce tumor-directed chemotaxis of innate immune cells through tumor-specific secretion of chemokines and stimulation of B16BL6 melanoma to secrete chemokines.

Winter H, van den Engel NK, Rüttinger D, Schmidt J, Schiller M, Poehlein CH, Löhe F, Fox BA, Jauch KW, Hatz RA, Hu HM
Journal of translational medicine, 56 , 2007

Abstract:

BACKGROUND: The mechanisms by which tumor-specific T cells induce regression of established metastases are not fully characterized. In using the poorly immunogenic B16BL6-D5 (D5) melanoma model we reported that T cell-mediated tumor regression can occur independently of perforin, IFN-gamma or the combination of both. Characterization of regressing pulmonary metastases identified macrophages as a major component of the cells infiltrating the tumor after adoptive transfer of effector T cells. This led us to hypothesize that macrophages played a central role in tumor regression following T-cell transfer. Here, we sought to determine the factors responsible for the infiltration of macrophages at the tumor site. METHODS: These studies used the poorly immunogenic D5 melanoma model. Tumor-specific effector T cells, generated from tumor vaccine-draining lymph nodes (TVDLN), were used for adoptive immunotherapy and in vitro analysis of chemokine expression. Cellular infiltrates into pulmonary metastases were determined by immunohistochemistry. Chemokine expression by the D5 melanoma following co-culture with T cells, IFN-gamma or TNF-alpha was determined by RT-PCR and ELISA. Functional activity of chemokines was confirmed using a macrophage migration assay. T cell activation of macrophages to release nitric oxide (NO) was determined using GRIES reagent. RESULTS: We observed that tumor-specific T cells with a type 1 cytokine profile also expressed message for and secreted RANTES, MIP-1alpha and MIP-1beta following stimulation with specific tumor. Unexpectedly, D5 melanoma cells cultured with IFN-gamma or TNF-alpha, two type 1 cytokines expressed by therapeutic T cells, secreted Keratinocyte Chemoattractant (KC), MCP-1, IP-10 and RANTES and expressed mRNA for MIG. The chemokines released by T cells and cytokine-stimulated tumor cells were functional and induced migration of the DJ2PM macrophage cell line. Additionally, tumor-specific stimulation of wt or perforin-deficient (PKO) effector T cells induced macrophages to secrete nitric oxide (NO), providing an additional effector mechanism for T cell-mediated tumor regression. CONCLUSION: These data suggest two possible sources for chemokine secretion that stimulates macrophage recruitment to the site of tumor metastases. Both appear to be initiated by T cell recognition of specific antigen, but one is dependent on the tumor cells to produce the chemokines that recruit macrophages.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1234/CCR5
EntrezGene:12981/Csf2
EntrezGene:1437/CSF2
EntrezGene:16183/Il2
EntrezGene:3439/IFNA1
EntrezGene:3558/IL2
EntrezGene:3627/CXCL10
EntrezGene:4283/CXCL9
EntrezGene:6347/CCL2
EntrezGene:6348/CCL3
EntrezGene:6352/CCL5
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7462/LAT2

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Ccl4 ENSMUSG00000018930 2,3
Cxcl10 ENSMUSG00000034855 6,7
Cxcl9 ENSMUSG00000029417 10,11
Ccl2 ENSMUSG00000035385 12,13
Tnf ENSMUSG00000024401 14,15
Si ENSMUSG00000025359 16,17
Hprt1 ENSMUSG00000025630 18,19
Ccr1 ENSMUSG00000025804 20,21
Ccr5 ENSMUSG00000079227 23,22

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
14, 15 chr17:35337219-35338055
12, 13 chr11:81850001-81850644
18, 19 chrX:50373309-50374499
24 chr17:39983753-39983773
20, 21 chr9:123879160-123879263
6, 7, 10, 11 chr5:92752824-92777141
22, 23 chr9:124040042-124040142
16, 17 chr10:128153405-128154851
24 chr6:3150897-3150917
0, 3 chr11:83462754-83477924

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2203985.pdf ATGAAGGTCTCCACCACTGCCCTTG
1 PMC2203985.pdf GGCATTCAGTCCAGGTCAGTGAT
2 PMC2203985.pdf GTTCTCAGCACCAATGGGCTCTGA
3 PMC2203985.pdf CTCTCCTGAAGTGGCTCCTCCTG
4 PMC2203985.pdf CGGAATTCGCCACCAGCCGCCTG
5 PMC2203985.pdf CGTCTAGACTTTCTCCGTTACTTGG
6 PMC2203985.pdf CCTATCCTGCCCACGTGTTG
7 PMC2203985.pdf CGCACCTCCACATAGCTTACA
8 PMC2203985.pdf CATCCTCACTGCAGCCGCCC
9 PMC2203985.pdf CCAAGCTGGGTAGGACTAGAG
10 PMC2203985.pdf ATGAAGTCCGCTGTTCTTTTCC
11 PMC2203985.pdf TTATGTAGTCTTCCTTGAACGAC
12 PMC2203985.pdf CTCACCTGCTGCTACTCATTC
13 PMC2203985.pdf GCTTGAGGTGGTTGTGGAAAA
14 PMC2203985.pdf GTTCTATGGCCCAGACCCTCACA
15 PMC2203985.pdf TACCAGGGTTTGAGCTCAGC
16 PMC2203985.pdf AAATGCCAACCACAGAGGTC
17 PMC2203985.pdf CAAGCATTATGGTGTCGGTG
18 PMC2203985.pdf GTTGGATACAGGCCAGACTTTGTTG
19 PMC2203985.pdf GAGGGTAGGCTGGCCTATAGGCT
20 PMC2203985.pdf CCACTCCATGCCAAAAGACT
21 PMC2203985.pdf ACTAGGACATTGCCCACCAC
22 PMC2203985.pdf CGAAAACACATGGTCAAACG
23 PMC2203985.pdf GTTCTCCTGTGGATCGGGTA
24 PMC2203985.pdf CGGCTACCACATCCAAGGAA
Display recognized sequences in FASTA format