text2genome

About us

Related Links

Press Coverage

PubMed: 20157568    PubMedCentral: PMC2815738

The mRNA decay factor tristetraprolin (TTP) induces senescence in human papillomavirus-transformed cervical cancer cells by targeting E6-AP ubiquitin ligase.

Sanduja S, Kaza V, Dixon DA
Aging, 803 , 2009

Abstract:

The RNA-binding protein tristetraprolin (TTP) regulates expression of many cancer-associated and proinflammatory factors through binding AU-rich elements (ARE) in the 3'-untranslated region (3'UTR) and facilitating rapid mRNA decay. Here we report on the ability of TTP to act in an anti-proliferative capacity in HPV18-positive HeLa cells by inducing senescence. HeLa cells maintain a dormant p53 pathway and elevated telomerase activity resulting from HPV-mediated transformation, whereas TTP expression counteracted this effect by stabilizing p53 protein and inhibiting hTERT expression. Presence of TTP did not alter E6 and E7 viral mRNA levels indicating that these are not TTP targets. It was found that TTP promoted rapid mRNA decay of the cellular ubiquitin ligase E6-associated protein (E6-AP). RNA-binding studies demonstrated TTP and E6-AP mRNA interaction and deletion of the E6-AP mRNA ARE-containing 3'UTR imparts resistance to TTP-mediated downregulation. Similar results were obtained with high-risk HPV16-positive cells that employ the E6-AP pathway to control p53 and hTERT levels. Furthermore, loss of TTP expression was consistently observed in cervical cancer tissue compared to normal tissue. These findings demonstrate the ability of TTP to act as a tumor suppressor by inhibiting the E6-AP pathway and indicate TTP loss to be a critical event during HPV-mediated carcinogenesis.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
ZFP36 ENSG00000128016 0,1
TP53 ENSG00000141510 2,3
TERT ENSG00000164362 4,5
UBE3A ENSG00000114062 8,9
GAPDH ENSG00000111640 10,11

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr19:39898851-39899056
8, 9 chr15:25583640-25583932
3 chr17:7578204-7578230
10, 11 chr12:6645871-6646973
4, 5 chr5:1293990-1294204

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2815738.pdf TCCACAACCCTAGCGAAGAC
1 PMC2815738.pdf GAGAAGGCAGAGGGTGACAG
2 PMC2815738.pdf CAGCCAAGTCTGTGACTTGCACGTAC
3 PMC2815738.pdf CTATGTCGAAAAGTGTTTCTGTCATC
4 PMC2815738.pdf GTGACCGTGGTTTCTGTGTG
5 PMC2815738.pdf TCGCCTGAGGAGTAGAGGAA
6 PMC2815738.pdf TATGCATGGACCTAAGGCAAC
7 PMC2815738.pdf TTACTGCTGGGATGCACACC
8 PMC2815738.pdf GCTTGAGGTTGAGCCTTTTG
9 PMC2815738.pdf CCAATTTCTCCCTTCCTTCC
10 PMC2815738.pdf CCACCCATGGCAAATTCCATGGCA
11 PMC2815738.pdf TCTAGACGGCAGGTCAGGTCCACC
Display recognized sequences in FASTA format