text2genome

About us

Related Links

Press Coverage

PubMed: 11433042    PubMedCentral: PMC55790

Reproducible and inexpensive probe preparation for oligonucleotide arrays.

Zhang Y, Price BD, Tetradis S, Chakrabarti S, Maulik G, Makrigiorgos GM
Nucleic acids research, e66 , 2001

Abstract:

We present a new protocol for the preparation of nucleic acids for microarray hybridization. DNA is fragmented quantitatively and reproducibly by using a hydroxyl radical-based reaction, which is initiated by hydrogen peroxide, iron(II)-EDTA and ascorbic acid. Following fragmentation, the nucleic acid fragments are densely biotinylated using a biotinylated psoralen analog plus UVA light and hybridized on microarrays. This non-enzymatic protocol circumvents several practical difficulties associated with DNA preparation for microarrays: the lack of reproducible fragmentation patterns associated with enzymatic methods; the large amount of labeled nucleic acids required by some array designs, which is often combined with a limited amount of starting material; and the high cost associated with currently used biotinylation methods. The method is applicable to any form of nucleic acid, but is particularly useful when applying double-stranded DNA on oligonucleotide arrays. Validation of this protocol is demonstrated by hybridizing PCR products with oligonucleotide-coated microspheres and PCR amplified cDNA with Affymetrix Cancer GeneChip microarrays.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:2678/GGT1

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 1,2,3

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1, 2, 3 chr17:7572826-7573980

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC55790.pdf AgCACTCTCCAgCCTCTCACCgCA
1 PMC55790.pdf ACTCAAGGATGCCCAGGCTG
2 PMC55790.pdf CCTATTGCAAGCAAGGGTTC
3 PMC55790.pdf ggTCAgTCTACCTCCCgCCATAAAA
Display recognized sequences in FASTA format