text2genome

About us

Related Links

Press Coverage

PubMed: 18633110    PubMedCentral: PMC2551683

Alterations in microRNA expression contribute to fatty acid-induced pancreatic beta-cell dysfunction.

Lovis P, Roggli E, Laybutt DR, Gattesco S, Yang JY, Widmann C, Abderrahmani A, Regazzi R
Diabetes, 2728 , 2008

Abstract:

OBJECTIVE: Visceral obesity and elevated plasma free fatty acids are predisposing factors for type 2 diabetes. Chronic exposure to these lipids is detrimental for pancreatic beta-cells, resulting in reduced insulin content, defective insulin secretion, and apoptosis. We investigated the involvement in this phenomenon of microRNAs (miRNAs), a class of noncoding RNAs regulating gene expression by sequence-specific inhibition of mRNA translation. RESEARCH DESIGN AND METHODS: We analyzed miRNA expression in insulin-secreting cell lines or pancreatic islets exposed to palmitate for 3 days and in islets from diabetic db/db mice. We studied the signaling pathways triggering the changes in miRNA expression and determined the impact of the miRNAs affected by palmitate on insulin secretion and apoptosis. RESULTS: Prolonged exposure of the beta-cell line MIN6B1 and pancreatic islets to palmitate causes a time- and dose-dependent increase of miR34a and miR146. Elevated levels of these miRNAs are also observed in islets of diabetic db/db mice. miR34a rise is linked to activation of p53 and results in sensitization to apoptosis and impaired nutrient-induced secretion. The latter effect is associated with inhibition of the expression of vesicle-associated membrane protein 2, a key player in beta-cell exocytosis. Higher miR146 levels do not affect the capacity to release insulin but contribute to increased apoptosis. Treatment with oligonucleotides that block miR34a or miR146 activity partially protects palmitate-treated cells from apoptosis but is insufficient to restore normal secretion. CONCLUSIONS: Our findings suggest that at least part of the detrimental effects of palmitate on beta-cells is caused by alterations in the level of specific miRNAs.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:2201/FBN2
EntrezGene:22318/Vamp2
EntrezGene:24842/P53_RAT
EntrezGene:2597/GAPDH
EntrezGene:2688/GH1
EntrezGene:31/ACACA
EntrezGene:3654/IRAK1
EntrezGene:3815/KIT
EntrezGene:4594/MUT
EntrezGene:4858/NOVA2
EntrezGene:5864/RAB3A
EntrezGene:5873/RAB27A
EntrezGene:6616/SNAP25
EntrezGene:6804/STX1A
EntrezGene:6844/VAMP2
EntrezGene:7157/TP53
EntrezGene:7189/TRAF6
EntrezGene:788/SLC25A20
EntrezGene:94121/SYTL4
EntrezGene:9501/RPH3AL

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Ins2 ENSMUSG00000000215 1,0
Trp53 ENSMUSG00000059552 2,3
Gapdh ENSMUSG00000057666 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
4, 5 chr15:12505127-12505199
4, 5 chr18:54144464-54144536
4, 5 chr17:14846544-14846616
4, 5 chr15:93027511-93027583
4, 5 chr15:4835603-4835675
2, 3 chr17:54559299-54559379
4, 5 chr10:22511629-22511701
4, 5 chr7:96756688-96756760
4, 5 chr1:13776409-13776481
4, 5 chr19:40287357-40287429
4, 5 chr3:69370801-69370873
4, 5 chr8:60029582-60029654
4, 5 chr11:3852214-3852286
4, 5 chr8:95240271-95240343
4, 5 chr2:43374362-43374434
4, 5 chr5:28865593-28865665
4, 5 chr14:12113891-12113963
4, 5 chr3:61266227-61266299
4, 5 chr1:182257747-182257819
4, 5 chr17:61920783-61920855
2, 3 chr11:69401072-69401888
4, 5 chr3:78721663-78721735
4, 5 chr11:26687116-26687188
6, 7 chr4:149442581-149442604
4, 5 chr11:99539929-99540001
4, 5 chrX:148380393-148380465
4, 5 chr5:106292165-106292237
4, 5 NT_166349:396905-396977
4, 5 chr7:107909764-107909836
4, 5 chrX:77439635-77439707
4, 5 chr13:17913269-17913341
4, 5 chr1:152984009-152984081
4, 5 chr3:142626058-142626130
4, 5 chr2:28789573-28789645
0, 1 chr7:149864616-149865301
8, 9 chr11:43187936-43187958
4, 5 chr5:96291216-96291288
4, 5 chr9:51431341-51431413
4, 5 chr6:91379360-91379432
4, 5 chr3:139312826-139312898
4, 5 chr14:49028784-49028856
4, 5 chr5:13042878-13042950
4, 5 chr6:128152695-128152767
4, 5 chr10:33528745-33528817
4, 5 chr6:125112689-125112895
4, 5 chr7:49381017-49381089
4, 5 chr7:59002550-59002622
4, 5 chr3:121933558-121933630
4, 5 chr1:15259325-15259397
4, 5 chr6:83824818-83824890
4, 5 chr2:149569394-149569466
4, 5 chr2:104132214-104132286
4, 5 chr14:103770127-103770199
4, 5 chr8:77929862-77929934
4, 5 chr4:91518804-91518876

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2551683.pdf TGGCTTCTTCTACACACCCA
1 PMC2551683.pdf TCTAGTTGCAGTAGTTCTCCA
2 PMC2551683.pdf GCAACTATGGCTTCCACCTG
3 PMC2551683.pdf AGCTTATTGAGGGGAGGAGAGT
4 PMC2551683.pdf TCCATGACAACTTTGGCATTG
5 PMC2551683.pdf CAGTCTTCTGGGTGGCAGTGA
6 PMC2551683.pdf TGGCAGTGTCTTAGCTGGTTGTT
7 PMC2551683.pdf AACAACCAGCTAAGACACTGCCA
8 PMC2551683.pdf TGAGAACTGAATTCCATGGGTT
9 PMC2551683.pdf AACCCATGGAATTCAGTTCTCA
10 PMC2551683.pdf CACCCCTTCTCGAGGTTCCCATC
11 PMC2551683.pdf GCGCCACAGAATTCGGGGCATG
Display recognized sequences in FASTA format