text2genome

About us

Related Links

Press Coverage

PubMed: 17150094    PubMedCentral: PMC1764728

Parecoxib is neuroprotective in spontaneously hypertensive rats after transient middle cerebral artery occlusion: a divided treatment response?

Kelsen J, Kjaer K, Chen G, Pedersen M, Røhl L, Frøkiaer J, Nielsen S, Nyengaard JR, Rønn LC
Journal of neuroinflammation, 31 , 2006

Abstract:

BACKGROUND: Anti-inflammatory treatment affects ischemic damage and neurogenesis in rodent models of cerebral ischemia. We investigated the potential benefit of COX-2 inhibition with parecoxib in spontaneously hypertensive rats (SHRs) subjected to transient middle cerebral artery occlusion (tMCAo). METHODS: Sixty-four male SHRs were randomized to 90 min of intraluminal tMCAo or sham surgery. Parecoxib (10 mg/kg) or isotonic saline was administered intraperitoneally (IP) during the procedure, and twice daily thereafter. Nineteen animals were euthanized after 24 hours, and each hemisphere was examined for mRNA expression of pro-inflammatory cytokines and COX enzymes by quantitative RT-PCR. Twenty-three tMCAo animals were studied with diffusion and T2 weighted MRI within the first 24 hours, and ten of the SHRs underwent follow-up MRI six days later. Thirty-three SHRs were given 5-bromo-2'-deoxy-uridine (BrdU) twice daily on Day 4 to 7 after tMCAo. Animals were euthanized on Day 8 and the brains were studied with free-floating immunohistochemistry for activated microglia (ED-1), hippocampal granule cell BrdU incorporation, and neuronal nuclei (NeuN). Infarct volume estimation was done using the 2D nucleator and Cavalieri principle on NeuN-stained coronal brain sections. The total number of BrdU+ cells in the dentate gyrus (DG) of the hippocampus was estimated using the optical fractionator. RESULTS: We found a significant reduction in infarct volume in parecoxib treated animals one week after tMCAo (p < 0.03). Cortical ADC values in the parecoxib group were markedly less increased on Day 8 (p < 0.01). Interestingly, the parecoxib treated rats were segregated into two subgroups, suggesting a responder vs. non-responder phenomenon. We found indications of mRNA up-regulation of IL-1beta, IL-6, TNF-alpha and COX-2, whereas COX-1 remained unaffected. Hippocampal granule cell BrdU incorporation was not affected by parecoxib treatment. Presence of ED-1+ activated microglia in the hippocampus was related to an increase in BrdU uptake in the DG. CONCLUSION: IP parecoxib administration during tMCAo was neuroprotective, as evidenced by a large reduction in mean infarct volume and a lower cortical ADC increment. Increased pro-inflammatory cytokine mRNA levels and hippocampal granule cell BrdU incorporation remained unaffected.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1896/EDA
EntrezGene:3569/IL6
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7462/LAT2

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1 chr2:36093271-36093293
1 chr10:84898020-84898055
0 chr1:113953265-113953283

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1764728.pdf GTACTATCCCTGAGATCTGGACTGAGATACGTGTTGACGTCCCTCTTCTCATTCCTGCTCGTCATAAGCCAACAAGTGGTATTCTCCAGGGAGATCTTGGAAATGAGTGACGGTCAGGTCATCACTATC
1 PMC1764728.pdf TGAGTACTTCTCGGATGAAGGTTCCTTATTTCCTTTCACACCCGAGAAGATGATCTGAGTGTGAGTGTTTGGGATCCACACTCTCGGCAAATTTCCTGGTTATATCCTGACGGTCAGGTCATCACTATC
Display recognized sequences in FASTA format