text2genome

About us

Related Links

Press Coverage

PubMed: 18549481    PubMedCentral: PMC2441632

TATA binding protein associated factor 3 (TAF3) interacts with p53 and inhibits its function.

Bereczki O, Ujfaludi Z, Pardi N, Nagy Z, Tora L, Boros IM, Balint E
BMC molecular biology, 57 , 2008

Abstract:

BACKGROUND: The tumour suppressor protein p53 is a sequence specific DNA-binding transcription regulator, which exerts its versatile roles in genome protection and apoptosis by affecting the expression of a large number of genes. In an attempt to obtain a better understanding of the mechanisms by which p53 transcription function is regulated, we studied p53 interactions. RESULTS: We identified BIP2 (Bric-à-brac interacting protein 2), the fly homolog of TAF3, a histone fold and a plant homeodomain containing subunit of TFIID, as an interacting partner of Drosophila melanogaster p53 (Dmp53). We detected physical interaction between the C terminus of Dmp53 and the central region of TAF3 both in yeast two hybrid assays and in vitro. Interestingly, DmTAF3 can also interact with human p53, and mammalian TAF3 can bind to both Dmp53 and human p53. This evolutionarily conserved interaction is functionally significant, since elevated TAF3 expression severely and selectively inhibits transcription activation by p53 in human cell lines, and it decreases the level of the p53 protein as well. CONCLUSION: We identified TAF3 as an evolutionarily conserved negative regulator of p53 transcription activation function.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:7157/TP53
EntrezGene:83860/TAF3
Genes found in fulltext (GNAT)
EntrezGene:11016/ATF7
EntrezGene:11091/WDR5
EntrezGene:11200/CHEK2
EntrezGene:209361/Taf3
EntrezGene:22059/Trp53
EntrezGene:2597/GAPDH
EntrezGene:326128/Rpb4
EntrezGene:34009/wg
EntrezGene:3622/ING2
EntrezGene:4193/MDM2
EntrezGene:43793/bip2
EntrezGene:472/ATM
EntrezGene:5205/ATP8B1
EntrezGene:57120/GOPC
EntrezGene:57162/PELI1
EntrezGene:6872/TAF1
EntrezGene:6878/TAF6
EntrezGene:6880/TAF9
EntrezGene:6880/AC145132.3
EntrezGene:6881/TAF10
EntrezGene:6908/TBP
EntrezGene:7157/TP53
EntrezGene:7161/TP73
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:83860/TAF3
EntrezGene:856096/TAF3
EntrezGene:8626/TP63

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 2,3
GAPDH ENSG00000111640 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1 chr10:8007511-8007531
4, 5 chr12:6646954-6647305
2, 3 chr17:7578416-7579396

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2441632.pdf AGAATTCAGTTACTCCAGGTCGTTGTTG
1 PMC2441632.pdf AAAGTCGACGGAAGCACTGGCAACAAAG
2 PMC2441632.pdf CCCTTCCCAGAAAACCTACC
3 PMC2441632.pdf CTCCGTCATGTGCTGTGACT
4 PMC2441632.pdf ACCTGACCTGCCGTCTAGAA
5 PMC2441632.pdf TCCACCACCCTGTTGCTGTA
Display recognized sequences in FASTA format