text2genome

About us

Related Links

Press Coverage

PubMed: 19033365    PubMedCentral: PMC2615618

Identification of a signature motif in target mRNAs of RNA-binding protein AUF1.

Mazan-Mamczarz K, Kuwano Y, Zhan M, White EJ, Martindale JL, Lal A, Gorospe M
Nucleic acids research, 204 , 2009

Abstract:

The ubiquitous RNA-binding protein AUF1 promotes the degradation of some target mRNAs, but increases the stability and translation of other targets. Here, we isolated AUF1-associated mRNAs by immunoprecipitation of (AUF1-RNA) ribonucleoprotein (RNP) complexes from HeLa cells, identified them using microarrays, and used them to elucidate a signature motif shared among AUF1 target transcripts. The predicted AUF1 motif (29-39 nucleotides) contained 79% As and Us, consistent with the AU-rich sequences of reported AUF1 targets. Importantly, 10 out of 15 previously reported AUF1 target mRNAs contained the AUF1 motif. The predicted interactions between AUF1 and target mRNAs were recapitulated in vitro using biotinylated RNAs. Interestingly, further validation of predicted AUF1 target transcripts revealed that AUF1 associates with both the pre-mRNA and the mature mRNA forms. The consequences of AUF1 binding to 10 predicted target mRNAs were tested by silencing AUF1, which elevated the steady-state levels of only four mRNAs, and by overexpressing AUF1, which also lowered the levels of only four mRNAs. In total, we have identified a signature motif in AUF1 target mRNAs, have found that AUF1 also associates with the corresponding pre-mRNAs, and have discovered that altering AUF1 levels alone only modifies the levels of subsets of target mRNAs.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1026/CDKN1A
EntrezGene:11991/Hnrnpd
EntrezGene:1437/CSF2
EntrezGene:1993/ELAVL2
EntrezGene:1994/ELAVL1
EntrezGene:219790/RTKN2
EntrezGene:23161/SNX13
EntrezGene:2353/FOS
EntrezGene:23670/TMEM2
EntrezGene:2597/GAPDH
EntrezGene:27230/SERP1
EntrezGene:282679/AQP11
EntrezGene:3184/HNRNPD
EntrezGene:3308/HSPA4
EntrezGene:3312/HSPA8
EntrezGene:3562/IL3
EntrezGene:3569/IL6
EntrezGene:3725/JUN
EntrezGene:51652/VPS24
EntrezGene:51715/RAB23
EntrezGene:55599/RNPC3
EntrezGene:5741/PTH
EntrezGene:595/CCND1
EntrezGene:596/BCL2
EntrezGene:7073/TIAL1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7157/TP53
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:7298/TYMS
EntrezGene:7430/VIL2
EntrezGene:8106/PABPN1
EntrezGene:821/CANX
EntrezGene:8570/KHSRP
EntrezGene:8626/TP63
EntrezGene:9782/MATR3

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 1,2
GAPDH ENSG00000111640 3,4
CANX ENSG00000127022 7,8,27,28
MATR3 ENSG00000015479 12,31,32,51,11
RTKN2 ENSG00000182010 13,14,33,34,53
SERP1 ENSG00000120742 15,16,35
VIL2 ENSG00000092820 17,18,37,38,57
RAB23 ENSG00000112210 23,24,43,44,63
AQP11 ENSG00000178301 26,45,5,6,25
VPS24 ENSG00000115561 30,49,9,10,29
SNX13 ENSG00000071189 40,59,60,19,20,39
TMEM2 ENSG00000135048 42,61,21,22,41

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
15, 16, 35, 55, 56 chr3:150261340-150262440
17, 18, 37, 38, 57, 58 chr6:159186821-159188190
19, 39, 40, 59, 60 chr7:17832976-17834132
11, 12, 31, 32, 51, 52 chr5:138643965-138666096
23, 24, 43, 44, 63 chr6:57054012-57055385
9, 29, 49, 50 chr2:86731843-86734776
5, 6, 25, 26, 45, 46 chr11:77301624-77320669
65 chr3:72426599-72426647
3, 4 chr12:6647129-6647536
22, 41, 42, 61, 62 chr9:74298841-74300487
7, 8, 27, 28, 47, 48 chr5:179132844-179157827
13, 14, 33, 34, 53, 54 chr10:63955647-63958384
1, 2 chr17:7572920-7579910

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2615618.pdf CCAAGCTTCTAATACGACTCACTATAGGGAGA
1 PMC2615618.pdf GGAGGAGCCGCAGTCAGATCCTAGC
2 PMC2615618.pdf AGAATGTCAGTCTGAGTCAGGC
3 PMC2615618.pdf CCTCAACGACCACTTTGTCA
4 PMC2615618.pdf GGTTGAGCACAGGGTACTTTAT
5 PMC2615618.pdf GCATAACAACCATACAATTAATAAAAA
6 PMC2615618.pdf AATGAGGCTTTTCTAGCAGCA
7 PMC2615618.pdf CAAGAAACAGAAAGCCACGA
8 PMC2615618.pdf TCGGTACATTTGAAAGCCTCT
9 PMC2615618.pdf CCAGCCACTGTCTCACAGAT
10 PMC2615618.pdf CCAGCACTGAAGCTCTTGGT
11 PMC2615618.pdf ATTGGCAGAAGAACGCAGAC
12 PMC2615618.pdf CATGGCCTAGGGTTTTCTTTT
13 PMC2615618.pdf CTCCAAGGCAGAAATCCATC
14 PMC2615618.pdf TGCTGTTGCTGACACCTTATG
15 PMC2615618.pdf TATCAGGATGGGCATGTGAA
16 PMC2615618.pdf ATGGCACATTGGACTCAACA
17 PMC2615618.pdf AGGCCGGGACAAGTACAAG
18 PMC2615618.pdf CACCTGCACATGGCATCTTA
19 PMC2615618.pdf GCAGAAAAGGTGACACTCCA
20 PMC2615618.pdf TGGGTTTAAAGGTATACACTGAGG
21 PMC2615618.pdf CTTAAGTGCTGGGGGAAAAA
22 PMC2615618.pdf GCAGGAGGGTGAACAGAAAA
23 PMC2615618.pdf ACCCAACAAACAAAGGACCA
24 PMC2615618.pdf CGCTGTCAGATGAAAACTGC
25 PMC2615618.pdf GGCTGCACTGGATTCATCA
26 PMC2615618.pdf TGAGGCTTTTCTAGCAGCATT
27 PMC2615618.pdf ATCGTTCATTGCCTTTCCAG
28 PMC2615618.pdf ATGGAGAGTGGGCATTTGAC
29 PMC2615618.pdf AAGTCAGGAGCTGACCAGGA
30 PMC2615618.pdf CCAGAGGATCTGGGTTTGAA
31 PMC2615618.pdf GTTTGAACCCGTTTTGGTTG
32 PMC2615618.pdf TCACGGGATTCAAGTGACAA
33 PMC2615618.pdf AGAAGATGCTGCAGGGAAAA
34 PMC2615618.pdf ACTCTGAGGGCACAACTGCT
35 PMC2615618.pdf AAAGCTACCGTGGTGGAGTG
36 PMC2615618.pdf ATGGCACATTGGACTCAACA
37 PMC2615618.pdf AACCATGGCACTTGATGTGA
38 PMC2615618.pdf TGCACGAGAAGGAATGAGTG
39 PMC2615618.pdf AGAGAAAACTGCCCCCATCT
40 PMC2615618.pdf CACAGCCCTTAAAGCACACA
41 PMC2615618.pdf AAAAGGAGCGCTTTCTAGGG
42 PMC2615618.pdf GGCATTTTGCTGCTTCTTTC
43 PMC2615618.pdf CCTGTGAAGTGTGGTGATGC
44 PMC2615618.pdf TGTGGGACTGACAGCTCTTG
45 PMC2615618.pdf GGCTGCACTCATCACCTTTT
46 PMC2615618.pdf TGTCGGCCCTACTGGTTAAG
47 PMC2615618.pdf TCTCCCAAGGTTTGAAATGG
48 PMC2615618.pdf CGAATTTTGCTTTCCCTTTG
49 PMC2615618.pdf CTGATCGTCCATGCTTTCAA
50 PMC2615618.pdf AGGGTGTCTGATGGGAACAG
51 PMC2615618.pdf GGTTATCCCCATCTGTGCTC
52 PMC2615618.pdf TGCTTGATCAACTCAATGTCATC
53 PMC2615618.pdf CAAGTTTCATAGGTGAATCAATGC
54 PMC2615618.pdf TAGTGCAGCGCATGATCTTT
55 PMC2615618.pdf TTTGAATAATCTGGAAAATTGCTG
56 PMC2615618.pdf CAGGCCTGTCTTCACTTCTT
57 PMC2615618.pdf CCTCATGTTCTCGTTGTGGA
58 PMC2615618.pdf TTGCCCTTCCTGTTTTCCTA
59 PMC2615618.pdf CAGCCCCAATAATGTGCTTC
60 PMC2615618.pdf TTGTCTCCCAGTAGCTTTTGC
61 PMC2615618.pdf TTTCCACTGAATCCCAAAAA
62 PMC2615618.pdf TTGTTATCTGGGGCAAAAGG
63 PMC2615618.pdf CGGAGTGACTTCCACCAGAT
64 PMC2615618.pdf CCACTGAACCGTATGCCTAAA
65 PMC2615618.pdf TGACATATACTAAATAAAAAAATGAATATGTTGATCATTTTATACTGAGTAGTAGAAAGAAGCTAATTTGAAATAAGTTTTTAATAAAACTACAGTACTTTGTGTATTTTTGGATGTATCAAGAACCTTCCGGACAACAGGTGTGGACCCTGGCCTCAGAGGCCTTGCTGGTGTTACATAAGCACTCATGAAAATATGGTATTCTGTGACTTAGTGTAACCTAGGAGATTTTATAGTTTTATTGAGACCATCATAGAGATCGATTCTTGTAC
Display recognized sequences in FASTA format