text2genome

About us

Related Links

Press Coverage

PubMed: 19077243    PubMedCentral: PMC2626600

Highly variable response to cytotoxic chemotherapy in carcinoma-associated fibroblasts (CAFs) from lung and breast.

Sonnenberg M, van der Kuip H, Haubeis S, Fritz P, Schroth W, Friedel G, Simon W, M├╝rdter TE, Aulitzky WE
BMC cancer, 364 , 2008

Abstract:

BACKGROUND: Carcinoma-associated fibroblasts (CAFs) can promote carcinogenesis and tumor progression. Only limited data on the response of CAFs to chemotherapy and their potential impact on therapy outcome are available. This study was undertaken to analyze the influence of chemotherapy on carcinoma-associated fibroblasts (CAFs) in vitro and in vivo. METHODS: The in vivo response of stromal cells to chemotherapy was investigated in 22 neoadjuvant treated breast tumors on tissue sections before and after chemotherapy. Response to chemotherapy was analyzed in vitro in primary cultures of isolated CAFs from 28 human lung and 9 breast cancer tissues. The response was correlated to Mdm2, ERCC1 and TP53 polymorphisms and TP53 mutation status. Additionally, the cytotoxic effects were evaluated in an ex vivo experiment using cultured tissue slices from 16 lung and 17 breast cancer specimens. RESULTS: Nine of 22 tumors showed a therapy-dependent reduction of stromal activity. Pathological response of tumor or stroma cells did not correlate with clinical response. Isolated CAFs showed little sensitivity to paclitaxel. In contrast, sensitivity of CAFs to cisplatinum was highly variable with a GI50 ranging from 2.8 to 29.0 microM which is comparable to the range observed in tumor cell lines. No somatic TP53 mutation was detected in any of the 28 CAFs from lung cancer tissue. In addition, response to cisplatinum was not significantly associated with the genotype of TP53 nor Mdm2 and ERCC1 polymorphisms. However, we observed a non-significant trend towards decreased sensitivity in the presence of TP53 variant genotype. In contrast to the results obtained in isolated cell culture, in tissue slice culture breast cancer CAFs responded to paclitaxel within their microenvironment in the majority of cases (9/14). The opposite was observed in lung cancer tissues: only few CAFs were sensitive to cisplatinum within their microenvironment (2/15) whereas a higher proportion responded to cisplatinum in isolated culture. CONCLUSION: Similar to cancer cells, CAF response to chemotherapy is highly variable. Beside significant individual/intrinsic differences the sensitivity of CAFs seems to depend also on the cancer type as well as the microenvironment.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1026/CDKN1A
EntrezGene:11162/NUDT6
EntrezGene:2067/ERCC1
EntrezGene:2191/FAP
EntrezGene:2272/FHIT
EntrezGene:2335/FN1
EntrezGene:3815/KIT
EntrezGene:4193/MDM2
EntrezGene:4288/MKI67
EntrezGene:7157/TP53
EntrezGene:7422/VEGFA

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 2,3
ERCC1 ENSG00000012061 5,6

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr12:69202529-69202645
2, 3 chr17:7572740-7578428
5, 6 chr19:45918161-45924588

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2626600.pdf cgcgggagttcagggtaaag
1 PMC2626600.pdf actacgcgcagcgttcacac
2 PMC2626600.pdf ccacaacaaaacaccagtgc
3 PMC2626600.pdf cacatgacggaggttgtgag
4 PMC2626600.pdf ccacaacaaaacaccagtgc
5 PMC2626600.pdf cctcagacctacgccgaata
6 PMC2626600.pdf gctggtttctgctcataggc
Display recognized sequences in FASTA format