text2genome

About us

Related Links

Press Coverage

PubMed: 18793399    PubMedCentral: PMC2553764

Sepsis causes neuroinflammation and concomitant decrease of cerebral metabolism.

Semmler A, Hermann S, Mormann F, Weberpals M, Paxian SA, Okulla T, Schäfers M, Kummer MP, Klockgether T, Heneka MT
Journal of neuroinflammation, 38 , 2008

Abstract:

BACKGROUND: Septic encephalopathy is a severe brain dysfunction caused by systemic inflammation in the absence of direct brain infection. Changes in cerebral blood flow, release of inflammatory molecules and metabolic alterations contribute to neuronal dysfunction and cell death. METHODS: To investigate the relation of electrophysiological, metabolic and morphological changes caused by SE, we simultaneously assessed systemic circulation, regional cerebral blood flow and cortical electroencephalography in rats exposed to bacterial lipopolysaccharide. Additionally, cerebral glucose uptake, astro- and microglial activation as well as changes of inflammatory gene transcription were examined by small animal PET using [18F]FDG, immunohistochemistry, and real time PCR. RESULTS: While the systemic hemodynamic did not change significantly, regional cerebral blood flow was decreased in the cortex paralleled by a decrease of alpha activity of the electroencephalography. Cerebral glucose uptake was reduced in all analyzed neocortical areas, but preserved in the caudate nucleus, the hippocampus and the thalamus. Sepsis enhanced the transcription of several pro- and anti-inflammatory cytokines and chemokines including tumor necrosis factor alpha, interleukin-1 beta, transforming growth factor beta, and monocot chemoattractant protein 1 in the cerebrum. Regional analysis of different brain regions revealed an increase in ED1-positive microglia in the cortex, while total and neuronal cell counts decreased in the cortex and the hippocampus. CONCLUSION: Together, the present study highlights the complexity of sepsis induced early impairment of neuronal metabolism and activity. Since our model uses techniques that determine parameters relevant to the clinical setting, it might be a useful tool to develop brain specific therapeutic strategies for human septic encephalopathy.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:24387/GFAP_RAT
EntrezGene:287435/NP_001026808.1

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
IL1B_RAT ENSRNOG00000004649 2,3
IL4_RAT ENSRNOG00000007624 4,5
IL6_RAT ENSRNOG00000010278 6,7
IL10_RAT ENSRNOG00000004647 8,9
TNFA_RAT ENSRNOG00000000837 10,11
TGFB1_RAT ENSRNOG00000020652 12,13
CCL2_RAT ENSRNOG00000007159 14,15
NOS2_RAT ENSRNOG00000011023 16,17

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
14, 15 chr10:70256364-70257648
2, 3 chr3:116964908-116967867
16, 17 chr10:65114657-65116565
16, 17 chr10:65061504-65063422
1 chr6:2255855-2267901
6, 7 chr4:458574-461109
12 chr1:80898680-80898700
8, 9 chr13:43953926-43954984
10, 11 chr20:3662043-3662721
5 chr10:39075754-39075774

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2553764.pdf ACGACAGTCCATGCCATCAC
1 PMC2553764.pdf TCCACCACCCTGTTGCTGTA
2 PMC2553764.pdf GCTACCTATGTCTTGCCCGTGGAG
3 PMC2553764.pdf GTCCCGACCATTGCTGTTTCCTA
4 PMC2553764.pdf GGATGTAACGACAGCCCTC
5 PMC2553764.pdf GACACCTCTACAGAGTTTCC
6 PMC2553764.pdf CTTGGGACTGATGTTGTTGA
7 PMC2553764.pdf CTCTGAATGACTCTGGCTTTG
8 PMC2553764.pdf CCTGCTCTTACTGGCTGGAG
9 PMC2553764.pdf CTGCAGTAAGGAATCTGTCAG
10 PMC2553764.pdf AAAACTCGAGTGACAAGCCC
11 PMC2553764.pdf GGTTGACCTCAGCGCTGAGC
12 PMC2553764.pdf TGCGCCTGCAGAGATTCAAG
13 PMC2553764.pdf TCTCTGTGGAGCTGAAGCAG
14 PMC2553764.pdf CTGTTGTTCACAGTTGCTGC
15 PMC2553764.pdf CTGATCTCACTTGGTTCTGG
16 PMC2553764.pdf CCAGAGCAGTACAAGCTCAC
17 PMC2553764.pdf CCACAACTCGCTCCAAGATC
Display recognized sequences in FASTA format