text2genome

About us

Related Links

Press Coverage

PubMed: 19008342    PubMedCentral: PMC2628612

Macrophage content in subcutaneous adipose tissue: associations with adiposity, age, inflammatory markers, and whole-body insulin action in healthy Pima Indians.

Ortega Martinez de Victoria E, Xu X, Koska J, Francisco AM, Scalise M, Ferrante AW, Krakoff J
Diabetes, 385 , 2009

Abstract:

OBJECTIVE: In severely obese individuals and patients with diabetes, accumulation and activation of macrophages in adipose tissue has been implicated in the development of obesity-associated complications, including insulin resistance. We sought to determine whether in a healthy population, adiposity, sex, age, or insulin action is associated with adipose tissue macrophage content (ATMc) and/or markers of macrophage activation. RESEARCH DESIGN AND METHODS: Subcutaneous ATMc from young adult Pima Indians with a wide range of adiposity (13-46% body fat, by whole-body dual-energy X-ray absorptiometry) and insulin action (glucose disposal rate 1.6-9 mg/kg estimated metabolic body size/min, by glucose clamp) were measured. We also measured expression in adipose tissue of factors implicated in macrophage recruitment and activation to determine any association with ATMc and insulin action. RESULTS: ATMc, as assessed by immunohistochemistry (Mphi) and by macrophage-specific gene expression (CD68, CD11b, and CSF1R), were correlated with percent body fat, age, and female sex. Gene expression of CD68, CD11b, and CSF1R but not Mphi was correlated negatively with glucose disposal rate but not after adjustment for percent body fat, age, and sex. However, adipose tissue expression of plasminogen activator inhibitor type-1 (PAI-1) and CD11 antigen-like family member C (CD11c), markers produced by macrophages, were negatively correlated with adjusted glucose disposal rate (r = -0.28, P = 0.05 and r = -0.31, P = 0.03). CONCLUSIONS: ATMc is correlated with age and adiposity but not with insulin action independent of adiposity in healthy human subjects. However, PAI-1 and CD11c expression are independent predictors of insulin action, indicating a possible role for adipose tissue macrophage activation.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:12402/Cbl
EntrezGene:12772/Ccr2
EntrezGene:1436/CSF1R
EntrezGene:1453/CSNK1D
EntrezGene:15894/Icam1
EntrezGene:16411/Itgax
EntrezGene:16846/Lep
EntrezGene:20296/Ccl2
EntrezGene:3091/HIF1A
EntrezGene:3383/ICAM1
EntrezGene:3684/ITGAM
EntrezGene:3687/ITGAX
EntrezGene:3952/LEP
EntrezGene:4282/MIF
EntrezGene:4318/MMP9
EntrezGene:6279/S100A8
EntrezGene:6347/CCL2
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:713/C1QB
EntrezGene:7422/VEGFA
EntrezGene:7462/LAT2
EntrezGene:968/CD68

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
CSNK1D ENSG00000141551 0,1
CD68 ENSG00000129226 2,3
ITGAX ENSG00000140678 5,25,26
CSF1R ENSG00000182578 6,7
LEP ENSG00000174697 8,9
ICAM1 ENSG00000090339 10,11
CCL2 ENSG00000108691 12,13
SERPINE1 ENSG00000106366 14,15
HIF1A ENSG00000100644 16,17
VEGFA ENSG00000112715 19,18
C1QB ENSG00000173369 20,21
TNF ENSG00000204490 23,24
TNF ENSG00000223952 23,24
TNF ENSG00000228321 23,24
TNF ENSG00000228849 23,24
TNF ENSG00000230108 23,24
TNF ENSG00000232810 23,24
TNF ENSG00000206439 24,23
MMP9 ENSG00000100985 27,28

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
12, 13 chr17:32583243-32583803
4 chr16:31289400-31289422
5, 25, 26 chr16:31374499-31390946
16, 17 chr14:62193442-62194269
23, 24 HSCHR6_MHC_QBL:31533846-31534816
10, 11 chr19:10394855-10395154
20, 21 chr1:22985984-22987355
23, 24 HSCHR6_MHC_DBB:31525749-31526717
8, 9 chr7:127892107-127894486
0, 1 chr17:80213392-80223656
23, 24 HSCHR6_MHC_MCF:31619914-31620882
6 chr5:149452970-149452992
18 chr6:43739013-43739034
15 chr7:100780325-100780347
23, 24 HSCHR6_MHC_SSTO:31533548-31534516
23, 24 chr6:31543605-31544573
22 chr1:153362683-153362705
2, 3 chr17:7484056-7484741
7 chrX:27877840-27877962
27, 28 chr20:44638538-44639266

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2628612.pdf AGGAGAAGAGGTTGCCATCAAG
1 PMC2628612.pdf TCCATCACCATGACGTTGTAGTC
2 PMC2628612.pdf GCTACATGGCGGTGGAGTACAA
3 PMC2628612.pdf ATGATGAGAGGCAGCAAGATGG
4 PMC2628612.pdf GAGTCCAACGCTAATGTCAAGG
5 PMC2628612.pdf CCCGTAGAGAACAGCATCACAC
6 PMC2628612.pdf GCTCAACCTCAAAGTCATGGTG
7 PMC2628612.pdf GAAGGTGTGCCTGTATGTGTCC
8 PMC2628612.pdf TGGCCCTATCTTTTCTATGTCC
9 PMC2628612.pdf GGTGACTTTCTGTTTGGAGGAG
10 PMC2628612.pdf CAGTCACCTATGGCAACGACTC
11 PMC2628612.pdf GCCTCACACTTCACTGTCACCT
12 PMC2628612.pdf CAATCAATGCCCCAGTCACC
13 PMC2628612.pdf GAATCCTGAACCCACTTCTGC
14 PMC2628612.pdf CTGGTTCTGCCCAAGTTCTCC
15 PMC2628612.pdf CCACAAAGAGGAAGGGTCTGTC
16 PMC2628612.pdf AGAACAAAACACACAGCGAAGC
17 PMC2628612.pdf AATCAGCACCAAGCAGGTCATA
18 PMC2628612.pdf AGCCTTGCCTTGCTGCTCTAC
19 PMC2628612.pdf ACCACTTCGTGATGATTCTGCC
20 PMC2628612.pdf ACTGATGTTGCTCCTGCTCCTG
21 PMC2628612.pdf GGTCTCCCTTCTCTCCGAACTC
22 PMC2628612.pdf ATCCAACTCTTTGAACCAGACG
23 PMC2628612.pdf TGCTTGTTCCTCAGCCTCTTC
24 PMC2628612.pdf GCTTGTCACTCGGGGTTCG
25 PMC2628612.pdf ACCTTCTTGGCTACCTTTGACG
26 PMC2628612.pdf ATGGCTTTCCTTCTCCTCAGAC
27 PMC2628612.pdf CAGAGATGCGTGGAGAGTCG
28 PMC2628612.pdf GACACCAAACTGGATGACGATG
Display recognized sequences in FASTA format