text2genome

About us

Related Links

Press Coverage

PubMed: 16385659    PubMedCentral: PMC2810597

Differential expression, shedding, cytokine regulation and function of TNFR1 and TNFR2 in human fetal astrocytes.

Choi SJ, Lee KH, Park HS, Kim SK, Koh CM, Park JY
Yonsei medical journal, 818 , 2005

Abstract:

Tumor necrosis factor (TNF)-alpha induces pleiotropic cellular effects through a 55kDa, type 1 receptor (TNFR1) and a 75kDa type 2 receptor (TNFR2). Moreover, it participates in the pathogenesis of several CNS diseases, including demyelinating diseases. TNF-alpha receptors are differentially expressed and are regulated in many cell types. However, data regarding the TNF-alpha receptor expression and regulation in human astrocytes is limited to date. We investigated TNF- receptor expression, its regulation by cytokines, and its functional role in primary cultured human fetal astrocytes, which are the most abundant cellular population in the central nervous system and are known to be immunologically active. In this study, astrocytes were found to constitutively and predominantly transcribe, translate and shed TNFR1 rather than TNFR2, but TNFR2 expression was increased by adding TNF-alpha, IL-1, and IFN-gamma, but not by adding LPS. To determine the functional roles of TNFR1 and TNFR2 on TNF induction, we investigated NF-kappaB activation and TNF-alpha induction after neutralizing TNFR1 and TNFR2 by an antibody treatment. We found that NF-kappaB activation and TNF-alpha induction are blocked by TNFR1 neutralizing antibody treatments.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Homo sapiens
Dirofilaria repens
Dirofilaria immitis
Canis lupus familiaris

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNFRSF1A ENSG00000067182 0,1
TNFRSF1B ENSG00000028137 2,3
TNF ENSG00000204490 5,6
TNF ENSG00000206439 5,6
TNF ENSG00000223952 5,6
TNF ENSG00000228321 5,6
TNF ENSG00000228849 5,6
TNF ENSG00000230108 5,6
TNF ENSG00000232810 5,6

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3 chr1:12252536-12254070
4 chr1:117256485-117256505
6 HSCHR6_MHC_SSTO:31535220-31535249
4 chrX:15389161-15389181
6 HSCHR6_MHC_APD:31556598-31556627
4 chr6:135940333-135940353
0 chr12:6442662-6442682
6 HSCHR6_MHC_DBB:31527421-31527450
6 chr6:31545277-31545306
4 chr12:63149962-63149982
4 chr10:93426567-93426587
4 chr5:159377530-159377550
4 chr6:70456692-70456712
6 HSCHR6_MHC_COX:31532689-31532718
4 chr6:166478737-166478757
4 chr12:6647285-6647305
6 HSCHR6_MHC_QBL:31535520-31535549
6 HSCHR6_MHC_MANN:31584764-31584793
6 HSCHR6_MHC_MCF:31621586-31621615
4 chrX:46299171-46299191

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2810597.pdf AAATGGGTCAGGTGGAGATC
1 PMC2810597.pdf GGCTTAGTAGTAGTTCCTTC
2 PMC2810597.pdf CTCCAACACGACTTCATCCA
3 PMC2810597.pdf GACACAGTTCACCACTCCTA
4 PMC2810597.pdf TCCACCACCCTGTTGCTGTA
5 PMC2810597.pdf GAGTGACAAGCCTGTAGCCCATGTTGTAGCA
6 PMC2810597.pdf CAATGATCCCAAAGTAGACCTGCCCAGAC
7 PMC2810597.pdf AGTTGAGGGGACTTTCCCAGGC
Display recognized sequences in FASTA format