text2genome

About us

Related Links

Press Coverage

PubMed: 17712415    PubMedCentral: PMC1942083

Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

Nassanian H, Sanchez AM, Lo A, Bradley KA, Lee B
PloS one, , 2007

Abstract:

BACKGROUND: RNA interference (RNAi), mediated by small interfering RNA (siRNA), is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC). The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template. PRINCIPAL FINDINGS: We show here the use of a ligase chain reaction (LCR) to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each). Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells. CONCLUSIONS: The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:170786/Cd209a
EntrezGene:27130/INVS
EntrezGene:30835/CD209
EntrezGene:57120/GOPC
EntrezGene:7157/TP53
EntrezGene:7852/CXCR4
EntrezGene:83881/MIXL1

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
ACTB ENSG00000075624 16,17
CD209 ENSG00000090659 18,19
TP53 ENSG00000141510 21,22,23

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1, 4, 5, 8, 12, 13 chr14:20811584-20811674
16, 17 chr7:5568894-5568955
22, 23 chr17:7577576-7578283
18, 19 chr19:7811366-7812241

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1942083.pdf tgcaatCTGCAGATTTGCATgTCGCTATGTGTTCTGGGAAATCACC
1 PMC1942083.pdf ATAAACGTGAAATgtctttggatttgggaatcTTATAAgt
2 PMC1942083.pdf tctgtatgaATTcactcaaa
3 PMC1942083.pdf AGCGAcATGCAAATCTGCAGattgca
4 PMC1942083.pdf caaagacATTTCACGTTTATGGTGATTTCCCAGAACACAT
5 PMC1942083.pdf tttgagtgAATtcatacagaacTTATAAgattcccaaatc
6 PMC1942083.pdf tctgtatgaATTcactcaaaaacAATCCAGGCAAGACGCG
7 PMC1942083.pdf ATgtttttcagtAGATCTatacagaacTTATAAgattccc
8 PMC1942083.pdf aaatccaaagacATTTCACGTTTATGGTGATTTCCAGAA
9 PMC1942083.pdf CACATAGCGAcATGCAAATAAGCTTcggctc
10 PMC1942083.pdf tttgagtgAATtcatacaga
11 PMC1942083.pdf atAGATCTactgaaaaacATCGCGTCTTGCCTGGATTgtt
12 PMC1942083.pdf CGTGAAATgtctttggatttgggaatcTTATAAgttctgt
13 PMC1942083.pdf gagccgAAGCTTATTTGCATgTCGCTATGTGTTCTGGGAAATCACCATAAA
14 PMC1942083.pdf AATTCACTCAAAAACGACTCCAGTGGTAATCTACGTTTTTCAGTA
15 PMC1942083.pdf GATCTACTGAAAAACGTAGATTACCACTGGAGTCGTTTTTGAGTGCAGAAGGATTCCT
16 PMC1942083.pdf TGCCAGATTTTCTCCATGTC
17 PMC1942083.pdf TGAAGTACCCCATCGAGCACGGCAT
18 PMC1942083.pdf GCTGAGAGGCCTTGGATTCC
19 PMC1942083.pdf AGAGCGTGAAGGAGAGGAGTTG
20 PMC1942083.pdf ACCATGGCCAAGACACACCCTGCTA
21 PMC1942083.pdf CTGCTCAGATAGCGATGGTCTG
22 PMC1942083.pdf TTGTAGTGGATGGTGGTACAGTCA
23 PMC1942083.pdf CCCCTCCTCAGCATCTTATCCGAGTGG
Display recognized sequences in FASTA format