text2genome

About us

Related Links

Press Coverage

PubMed: 9207051    PubMedCentral: PMC146827

CCR: a rapid and simple approach for mutation detection.

Bi W, Stambrook PJ
Nucleic acids research, 2949 , 1997

Abstract:

We describe a simple approach for detecting known mutations in genomic DNA. The strategy entails a DNA amplification reaction that combines the use of thermostable DNA polymerase and ligase, and that has been designated the Combined Chain Reaction (CCR). CCR consists of four phases: denaturation, annealing, elongation and ligation. Unlike most PCR-based mutation detection systems it relies on mismatch between primer and template at the primer 5'ends. It is rapid and simple, and requires neither the use of radioactivity, nor polyacrylamide gel electrophoresis, nor autoradiography for mutation detection at the single base-pair level.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:5731/PTGER1

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 0,1,7,8

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1, 5, 6, 7, 8 chr17:7576637-7577522

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC146827.pdf CCGGCGCACAGAGGAAGAGAATCT
1 PMC146827.pdf GGTCTCTCCCAGGACAGGCACAAAC
2 PMC146827.pdf TTGGCGCACAGAGGAAGAGAATCT
3 PMC146827.pdf AATCTCTCCCAGGACAGGCACAAACCTAAGGCGCACAGAGGAAGAGAATCT
4 PMC146827.pdf TTTCTCTCCCAGGACAGGCACAAAC
5 PMC146827.pdf CCAGGTCAGGAGCCACTTGC
6 PMC146827.pdf TTGAGTGTTAGACTGGAAACTTTC
7 PMC146827.pdf CATCATCACACTGGAAGACTC
8 PMC146827.pdf TTTTGAAAGCTGGTCTGGTC
9 PMC146827.pdf CCGGCGCACAGAGGAAGAGAATCT
10 PMC146827.pdf GTCTCTCCCAGGACAGGCACAAACATACGGCGCACAGAGGAAGAGAATCT
11 PMC146827.pdf TTCTCTCCCAGGACAGGCACAAACGCGCGGCGCACAGAGGAAGAGAATCT
12 PMC146827.pdf CTCTCTCCCAGGACAGGCACAAACTATCGGCGCACAGAGGAAGAGAATCT
13 PMC146827.pdf ATCTCTCCCAGGACAGGCACAAACat
Display recognized sequences in FASTA format