text2genome

About us

Related Links

Press Coverage

PubMed: 15579413    PubMedCentral: PMC1253659

The sources of inflammatory mediators in the lung after silica exposure.

Rao KM, Porter DW, Meighan T, Castranova V
Environmental health perspectives, 1679 , 2004

Abstract:

The expression of 10 genes implicated in regulation of the inflammatory processes in the lung was studied after exposure of alveolar macrophages (AMs) to silica in vitro or in vivo. Exposure of AMs to silica in vitro up-regulated the messenger RNA (mRNA) levels of three genes [interleukin-6 (IL-6), monocyte chemoattractant protein-1 (MCP-1), and macrophage inflammatory protein-2 (MIP-2)] without a concomitant increase in the protein levels. AMs isolated after intratracheal instillation of silica up-regulated mRNA levels of four additional genes [granulocyte/macrophage-colony stimulating factor (GM-CSF), IL-1beta, IL-10, and inducible nitric oxide synthase]. IL-6, MCP-1, and MIP-2 protein levels were elevated in bronchoalveolar lavage fluid. Fibroblasts under basal culture conditions express much higher levels of IL-6 and GM-CSF compared with AMs. Coculture of AMs and alveolar type II cells, or coculture of AMs and lung fibroblasts, in contact cultures or Transwell chambers, revealed no synergistic effect. Therefore, such interaction does not explain the effects seen in vivo. Identification of the intercellular communication in vivo is still unresolved. However, fibroblasts appear to be an important source of inflammatory mediators in the lung.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:114105/CXCL2_RAT
EntrezGene:116630/CSF2_RAT
EntrezGene:1437/CSF2
EntrezGene:24498/IL6_RAT
EntrezGene:24599/NOS2_RAT
EntrezGene:24770/CCL2_RAT
EntrezGene:24835/TNFA_RAT
EntrezGene:25325/IL10_RAT
EntrezGene:3569/IL6
EntrezGene:3586/IL10
EntrezGene:4843/NOS2
EntrezGene:6347/CCL2
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
CSF2_RAT ENSRNOG00000026805 0,1
ICAM1_RAT ENSRNOG00000020679 2,3
IL6_RAT ENSRNOG00000010278 6,7
IL10_RAT ENSRNOG00000004647 8,9
NOS2_RAT ENSRNOG00000011023 10,11
CCL2_RAT ENSRNOG00000007159 12,13
TGFB1_RAT ENSRNOG00000020652 16,17
TNFA_RAT ENSRNOG00000000837 18,19

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
4 chr3:116967841-116967863
12, 13 chr10:70256350-70257160
16, 17 chr1:80895181-80898652
5 chr7:75491050-75491169
6, 7 chr4:457138-457280
2, 3 chr8:20050591-20050699
1 chr10:39666749-39666772
18, 19 chr20:3662545-3662661
8, 9 chr13:43953906-43954022
15 chr14:18677762-18677786

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1253659.pdf GACATGCGTGCTCTGGAGAACG
1 PMC1253659.pdf GCCATTGAGTTTGGTGAGGTTGC
2 PMC1253659.pdf AATCTGACCTGCAGCCGGAAAG
3 PMC1253659.pdf GGAGCTAAAGGCACGGCACTTG
4 PMC1253659.pdf AGCTCCACGGGCAAGACATAGG
5 PMC1253659.pdf GGATGGCTTCCAAGCCCTTGAC
6 PMC1253659.pdf CCCAACTTCCAATGCTCTCCTAATG
7 PMC1253659.pdf GCACACTAGGTTTGCCGAGTAGACC
8 PMC1253659.pdf GGCTCAGCACTGCTATGTTGCC
9 PMC1253659.pdf AGCATGTGGGTCTGGCTGACTG
10 PMC1253659.pdf GTCACCTATCGCACCCGAGATG
11 PMC1253659.pdf GCCACTGACACTCCGCACAAAG
12 PMC1253659.pdf TCACGCTTCTGGGCCTGTTG
13 PMC1253659.pdf CAGCCGACTCATTGGGATCATC
14 PMC1253659.pdf GGCAAGGCTAACTGACCTGGAAAG
15 PMC1253659.pdf CACATCAGGTACGATCCAGGCTTC
16 PMC1253659.pdf GCTAATGGTGGACCGCAACAAC
17 PMC1253659.pdf TGGCACTGCTTCCCGAATGTC
18 PMC1253659.pdf CGTCAGCCGATTTGCCATTTC
19 PMC1253659.pdf TGGGCTCATACCAGGGCTTGAG
20 PMC1253659.pdf GGACCAGAGCGAAAGCATTTGC
21 PMC1253659.pdf CGCCAGTCGGCATCGTTTATG
Display recognized sequences in FASTA format