text2genome

About us

Related Links

Press Coverage

PubMed: 15712600    PubMedCentral: PMC2270725

Intra-uterine growth restriction downregulates the hepatic toll like receptor-4 expression and function.

Equils O, Singh S, Karaburun S, Lu D, Thamotharan M, Devaskar SU
Clinical & developmental immunology, 59 , 2005

Abstract:

Maternal starvation is a significant cause of intrauterine growth restriction (IUGR) in the world and increases the risk of infection in the neonate. We examined the effect of maternal starvation on Toll like receptor (TLR)4 expression in hepatic, splenic and intestinal tissues obtained from the adult IUGR offspring of prenatal calorie restricted rats. The hepatic TLR4 protein concentration was undetectable in the IUGR rats that had restricted milk intake during the suckling period (SM/SP; n = 4. p < 0.05) as compared to the normal growth controls (CM/CP; n = 4), and access to ad lib milk intake during the sucking period partially corrected the hepatic TLR4 expression (SM/CP; n = 4). IUGR had no effect on the splenic (n = 4) or intestinal (n = 4) TLR4 mRNA levels. In the liver, IUGR led to a 20% increase in baseline tumor necrosis factor (TNF)-alpha mRNA expression (p < 0.03) and a 70% increase in interleukin-1beta (IL-1beta) mRNA expression (p < 0.008) as compared to the control rats (CM/CP; n = 7). LPS-induced hepatic TNF-alpha release was significantly higher in SM/SP as compared to CM/CP. We propose that IUGR dysregulates TLR4 expression and function in the offspring, which may help explain the increased risk of Gram-negative sepsis and inflammatory diseases in this population.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:29260/TLR4_RAT
Genes found in fulltext (GNAT)
EntrezGene:24383/G3P_RAT
EntrezGene:24494/IL1B_RAT
EntrezGene:24598/NOS1_RAT
EntrezGene:24835/TNFA_RAT
EntrezGene:2597/GAPDH
EntrezGene:29260/TLR4_RAT
EntrezGene:3553/IL1B
EntrezGene:3569/IL6
EntrezGene:7099/TLR4
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:929/CD14

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
G3P_RAT ENSRNOG00000018630 0,1
TNFA_RAT ENSRNOG00000000837 2,3
IL1B_RAT ENSRNOG00000004649 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr12:13672406-13673039
0, 1 chr16:25751283-25751921
0, 1 chr11:70680156-70680794
0, 1 chr4:161282886-161283812
0, 1 chr7:121242585-121243221
0, 1 chr5:73006517-73007154
0, 1 chr2:77118057-77118521
2, 3 chr20:3662577-3662764
5 chr3:116967140-116967160
0, 1 chr13:61676090-61676727
0, 1 chr5:117080364-117081002
0, 1 chr2:63229316-63229943
0, 1 chr3:127118034-127118672

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2270725.pdf ATCAACGACCCCTTCATTGA
1 PMC2270725.pdf AGATCCACAACGGATACATT
2 PMC2270725.pdf AAGTCAGCCTCCTCTCTGCC
3 PMC2270725.pdf AAGTAGACCTGCCCGGACTC
4 PMC2270725.pdf CATCTTTGAAGAAGAGCCCG
5 PMC2270725.pdf AGCTTTCAGCTCACATGGGT
Display recognized sequences in FASTA format