text2genome

About us

Related Links

Press Coverage

PubMed: 10684946    PubMedCentral: PMC111041

Species-specific regulation of alternative splicing in the C-terminal region of the p53 tumor suppressor gene.

Laverdière M, Beaudoin J, Lavigueur A
Nucleic acids research, 1489 , 2000

Abstract:

Alternative splicing occurs in the C-terminal region of the p53 tumor suppressor gene between two alternative 3' splice sites in intron 10. This alternative splicing event has been detected in murine cells, but not in rat or human tissues. In this paper, we have characterized the pattern of p53 alternative splicing in cell lines from five different species. Our results confirm that p53 alternative splicing is species-specific, being detected only in cell lines of rodent origin. Using transient transfection assays, we have established that the rat p53 gene undergoes efficient alternative splicing in both mouse and rat cell lines, thus demonstrating that it has all the necessary cis -acting sequences to be alternatively spliced. In contrast, we were unable to detect any usage of the human alternative 3' splice site under the same experimental conditions. Thus, the low levels or absence of alternatively spliced p53 mRNA in rat and human cell lines seems to be the result of different mechanisms. Our results support the hypothesis that there are species-specific mechanisms implicated in the regulation of p53 activity.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:22059/Trp53
EntrezGene:24842/P53_RAT
Genes found in fulltext (GNAT)
EntrezGene:11883/Arsa
EntrezGene:22059/Trp53
EntrezGene:22061/Trp63
EntrezGene:2263/FGFR2
EntrezGene:246334/P63_RAT
EntrezGene:24842/P53_RAT
EntrezGene:57120/GOPC
EntrezGene:7157/TP53
EntrezGene:7161/TP73
EntrezGene:8626/TP63

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Trp53 ENSMUSG00000059552 0,1,7,12,16

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1, 7, 12, 16 chr11:69403332-69404879

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC111041.pdf AACCACTTGATGGAGAGTATTTCACC
1 PMC111041.pdf TAATACGACCACTATAGGGAAGGCTTGGAAGGCTCTAGGCTGGAGG
2 PMC111041.pdf AACCACTTGATGGAGAGTATTTCACC
3 PMC111041.pdf TAATACGACTCACTATAGGGTCAGTCTGAGTCAGGCCC
4 PMC111041.pdf TAATACGACTCACTATAGGGTCAGTCTGAGTCAGGCCC
5 PMC111041.pdf GGTAAGGGAAGATTACGAGAC
6 PMC111041.pdf ACTTTCTTAGCCATTGTTTT
7 PMC111041.pdf AGACTGGCCCTTCTTGGTCTTCAGG
8 PMC111041.pdf GTCTCGAGCGCTTCGAGATGTTC
9 PMC111041.pdf GTCTCGAGCGCTTCGAGATGTTC
10 PMC111041.pdf GGAAGCTTCAGTCTGAGTCAGG
11 PMC111041.pdf TGTTCCGAGAGCTGAATGAGGCCT
12 PMC111041.pdf CGCTTCGAGATGTTCCGGGAGCTGAAT
13 PMC111041.pdf GGACTAGCATTGTCTTGTCAGC
14 PMC111041.pdf GGTGAAAGGGAGGATAAACTGA
15 PMC111041.pdf CGCTTCGAGATGTTCCGGGAGCTGAAT
16 PMC111041.pdf GATCAAGGCTTGGAAGGCTCTAGGCTGGA
Display recognized sequences in FASTA format