text2genome

About us

Related Links

Press Coverage

PubMed: 19756150    PubMedCentral: PMC2737642

A novel copper chelate modulates tumor associated macrophages to promote anti-tumor response of T cells.

Chatterjee S, Mookerjee A, Basu JM, Chakraborty P, Ganguly A, Adhikary A, Mukhopadhyay D, Ganguli S, Banerjee R, Ashraf M, Biswas J, Das PK, Sa G, Chatterjee M, Das T, Choudhuri SK
PloS one, , 2009

Abstract:

BACKGROUND: At the early stages of carcinogenesis, the induction of tumor specific T cell mediated immunity seems to block the tumor growth and give protective anti-tumor immune response. However, tumor associated macrophages (TAMs) might play an immunosuppressive role and subvert this anti tumor immunity leading to tumor progression and metastasis. METHODOLOGY/PRINCIPAL FINDINGS: The Cu (II) complex, (chelate), copper N-(2-hydroxy acetophenone) glycinate (CuNG), synthesized by us, has previously been shown to have a potential usefulness in immunotherapy of multiple drug resistant cancers. The current study demonstrates that CuNG treatment of TAMs modulates their status from immunosuppressive to proimmunogenic nature. Interestingly, these activated TAMs produced high levels of IL-12 along with low levels of IL-10 that not only allowed strong Th1 response marked by generation of high levels of IFN-gamma but also reduced activation induced T cell death. Similarly, CuNG treatment of peripheral blood monocytes from chemotherapy and/or radiotherapy refractory cancer patients also modulated their cytokine status. Most intriguingly, CuNG treated TAMs could influence reprogramming of TGF-beta producing CD4(+)CD25(+) T cells toward IFN-gamma producing T cells. CONCLUSION/SIGNIFICANCE: Our results show the potential usefulness of CuNG in immunotherapy of drug-resistant cancers through reprogramming of TAMs that in turn reprogram the T cells and reeducate the T helper function to elicit proper anti-tumorogenic Th1 response leading to effective reduction in tumor growth.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:12504/Cd4
EntrezGene:14102/Fas
EntrezGene:14433/380687-208
EntrezGene:16153/Il10
EntrezGene:16183/Il2
EntrezGene:16189/Il4
EntrezGene:21926/Tnf
EntrezGene:22173/Tyr
EntrezGene:2237/FEN1
EntrezGene:30794/Pdlim4
EntrezGene:3439/IFNA1
EntrezGene:355/FAS
EntrezGene:356/FASLG
EntrezGene:3565/IL4
EntrezGene:3586/IL10
EntrezGene:3815/KIT
EntrezGene:50943/FOXP3
EntrezGene:51497/TH1L
EntrezGene:74256/Cyld
EntrezGene:836/CASP3
EntrezGene:920/CD4
EntrezGene:929/CD14
EntrezGene:940/CD28

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tgfb1 ENSMUSG00000002603 0,1
Tnf ENSMUSG00000024401 2,3
Ifng ENSMUSG00000055170 4,5
Il4 ENSMUSG00000000869 6,7
AC121838.2-1 ENSMUSG00000055676 10,11

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3 chr17:35337815-35338785
0, 1 chr7:26489185-26489948
10, 11 chr1:182257591-182258161
9 chr1:132917563-132917584
4 chr10:117879517-117879538
6, 7 chr11:53426087-53432084

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2737642.pdf CTTTAGGAAGGACCTGGGTT
1 PMC2737642.pdf CAGGAGCGCACAATCATGTT
2 PMC2737642.pdf ATGAGCACAGAAAGCATGATC
3 PMC2737642.pdf TACAGGCTTGTCACTCGAATT
4 PMC2737642.pdf CTCAAGTGGCATAGATGTGGA
5 PMC2737642.pdf GACCTCAAACTTGGCAATACTC
6 PMC2737642.pdf GTCATCCTGCTCTTCTTTCTC
7 PMC2737642.pdf ATGCTCTTTAGGCTTTCCAG
8 PMC2737642.pdf ACTACCAAAGCCACAAAGCAG
9 PMC2737642.pdf AAGGAGTCGGTTAGCAGTATG
10 PMC2737642.pdf CCCACAGTAAATTCAACGGCAC
11 PMC2737642.pdf CATTGGGGTTAGGAACACGGA
Display recognized sequences in FASTA format