text2genome

About us

Related Links

Press Coverage

PubMed: 19951916    PubMedCentral: PMC2806584

The glycosaminoglycan-binding domain of PRELP acts as a cell type-specific NF-kappaB inhibitor that impairs osteoclastogenesis.

Rucci N, Rufo A, Alamanou M, Capulli M, Del Fattore A, Ahrman E, Capece D, Iansante V, Zazzeroni F, Alesse E, HeinegÄrd D, Teti A
The Journal of cell biology, 669 , 2009

Abstract:

Proline/arginine-rich end leucine-rich repeat protein (PRELP) is a glycosaminoglycan (GAG)- and collagen-binding anchor protein highly expressed in cartilage, basement membranes, and developing bone. We observed that PRELP inhibited in vitro and in vivo mouse osteoclastogenesis through its GAG-binding domain ((hbd)PRELP), involving (a) cell internalization through a chondroitin sulfate- and annexin II-dependent mechanism, (b) nuclear translocation, (c) interaction with p65 nuclear factor kappaB (NF-kappaB) and inhibition of its DNA binding, and (d) impairment of NF-kappaB transcriptional activity and reduction of osteoclast-specific gene expression. (hbd)PRELP does not disrupt the mitogen-activated protein kinase signaling nor does it impair cell survival. (hbd)PRELP activity is cell type specific, given that it is internalized by the RAW264.7 osteoclast-like cell line but fails to affect calvarial osteoblasts, bone marrow macrophages, and epithelial cell lines. In vivo, (hbd)PRELP reduces osteoclast number and activity in ovariectomized mice, underlying its physiological and/or pathological importance in skeletal remodeling.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:116847/Prelp
Species found in fulltext (Linnaeus)
Mus musculus
Bos taurus
Homo sapiens
Lateolabrax japonicus
Rattus norvegicus
Human immunodeficiency virus 1
Clostridium histolyticum
Oryza sativa

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Gapdh ENSMUSG00000057666 0,1
Alpl ENSMUSG00000028766 2,3
Bglap1 ENSMUSG00000074483 6,7
Runx2 ENSMUSG00000039153 10,11
Il6 ENSMUSG00000025746 12,13
Il1b ENSMUSG00000027398 14,15
Tnf ENSMUSG00000024401 20,21
Tnfsf11 ENSMUSG00000022015 23,24
Il12b ENSMUSG00000004296 25,26
Il18 ENSMUSG00000039217 27,28
Ctsk ENSMUSG00000028111 29,30
Calcr ENSMUSG00000023964 32,31
Mmp9 ENSMUSG00000017737 33,34
Tnfrsf11a ENSMUSG00000026321 35,36
Acp5 ENSMUSG00000001348 37,38
Sirpa ENSMUSG00000037902 39,40
Cd44 ENSMUSG00000005087 41,42
Tm7sf4 ENSMUSG00000022303 43,44

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
37, 38 chr9:21931275-21931694
0, 1 chr3:142625876-142626294
0, 1 chr3:139312644-139313062
27, 28 chr9:50385898-50389736
36 chr1:107723648-107723668
0, 1 chr10:39731979-39732397
18 chr3:107551728-107551749
0, 1 NT_166349:396723-397141
41, 42 chr2:102701752-102705493
0, 1 chr5:106292001-106292419
0, 1 chr8:60029400-60029818
0, 1 chr2:28789409-28789827
11 chr17:44745208-44745232
0, 1 chr10:22511447-22511810
0, 1 chr2:11330938-11331356
0, 1 chr6:125112525-125113175
29, 30 chr3:95306658-95312790
0, 1 chr13:49900594-49901012
0, 1 chr15:12504945-12505363
25, 26 chr11:44222057-44224572
0, 1 chr6:84762541-84762959
0, 1 chr10:33528581-33529002
0, 1 chr7:59002368-59002786
39, 40 chr2:129441266-129441451
0, 1 chr8:95240107-95240525
22 chr19:19709484-19709608
2, 3 chr4:137297912-137298151
0, 1 chr14:103769963-103770381
33 chr2:164780738-164780758
0, 1 chr14:49028602-49029020
0, 1 chr6:83824654-83825072
10 chr17:44795510-44795534
0, 1 chr14:12113727-12114145
0, 1 chr4:57384106-57384524
0, 1 chr5:96291034-96291452
0, 1 chr7:96756506-96756924
0, 1 chr11:26686934-26687352
12, 13 chr5:30340004-30341416
6, 7 chr3:88181809-88188307
20, 21 chr17:35336797-35337120
22 chr18:28971236-28971296
32 chr6:3637538-3637558
23, 24 chr14:78678616-78678756
43, 44 chr15:39586612-39590890
4 chr5:104864160-104864180
0, 1 chrX:77439471-77439889
0, 1 chr13:99172330-99172748
22 chr15:54087688-54087710
0, 1 chr11:20235296-20235714
0, 1 chr4:91518640-91519058

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2806584.S2.pdf CACCATGGAGAAGGCCGGGG
1 PMC2806584.S2.pdf GACGGACACATTGGGGGTAG
2 PMC2806584.S2.pdf CCAGCAGGTTTCTCTCTTGG
3 PMC2806584.S2.pdf CTGGGAGTCTCATCCTGAGC
4 PMC2806584.S2.pdf CTTGCTTGGGTTTGCAGTCT
5 PMC2806584.S2.pdf GCCAAATAGGCAAAAGCAAA
6 PMC2806584.S2.pdf ACCCTGGCTGCGCTCTGTCTCT
7 PMC2806584.S2.pdf GATGCGTTTGTAGGCGGTCTTCA
8 PMC2806584.S2.pdf GCAATCGGGATCAGTACGAA
9 PMC2806584.S2.pdf CTTTCACGCCTTTGAAGCGA
10 PMC2806584.S2.pdf AACCCACGGCCCTCCCTGAACTCT
11 PMC2806584.S2.pdf ACTGGCGGGGTGTAGGTAAAGGTG
12 PMC2806584.S2.pdf GAGGATACCACTCCCAACAGACC
13 PMC2806584.S2.pdf AAGTGCATCATCGTTGTTCATACA
14 PMC2806584.S2.pdf CAACCAACAAGTGATATTCTCCATG
15 PMC2806584.S2.pdf GATCCACACTCTCCAGCTGCA
16 PMC2806584.S2.pdf TGGTGTTCCTGCTCAGCTA
17 PMC2806584.S2.pdf CCTCGTCGTCTGACCCAAA
18 PMC2806584.S2.pdf GAATCTTCACTGGGCACTAAC
19 PMC2806584.S2.pdf CTTCCCATATGTCTCCTTTCC
20 PMC2806584.S2.pdf GCAGGTCTACTTTGGAGTCATTGC
21 PMC2806584.S2.pdf TCCCTTTGCAGAACTCAGGAATGG
22 PMC2806584.S2.pdf CCATCTGGACATTTTTTGCAAA
23 PMC2806584.S2.pdf CCAAGATCTCTAACATGACG
24 PMC2806584.S2.pdf CACCATCAGCTGAAGATAGT
25 PMC2806584.S2.pdf TTCAACATCAAGAGCAGTAG
26 PMC2806584.S2.pdf AGAACTTGAGGGAGAAGTAG
27 PMC2806584.S2.pdf CATCATCTTCCTTTTGGCAA
28 PMC2806584.S2.pdf ACTGTACAACCGCAGTAATACGG
29 PMC2806584.S2.pdf CTTCCAATACGTGCAGCAGA
30 PMC2806584.S2.pdf CCGAGCCAAGAGAGCATATC
31 PMC2806584.S2.pdf TTTCCAGGGATTCTTTGTGG
32 PMC2806584.S2.pdf CCGAGGAGCACTAACTACGC
33 PMC2806584.S2.pdf TGAATCAGCTGGCTTTTGTG
34 PMC2806584.S2.pdf GTGGATAGCTCGGTGGTGTT
35 PMC2806584.S2.pdf AAACCTTGGACCAACTGCAC
36 PMC2806584.S2.pdf ACCATCTTCTCCTCCCGAGT
37 PMC2806584.S2.pdf GAGAACGGTGTGGGCTATGT
38 PMC2806584.S2.pdf CTGTGGGATCAGTTGGTGTG
39 PMC2806584.S2.pdf GCTTCTCTCCCCGGAATATC
40 PMC2806584.S2.pdf CAAGGTGATGTGGGCTACCT
41 PMC2806584.S2.pdf TTACCCACCATGGACCAAAT
42 PMC2806584.S2.pdf TGTTGGACGTGACGAGGATA
43 PMC2806584.S2.pdf AAAACCCTTGGGCTGTTCTT
44 PMC2806584.S2.pdf AATCATGGACGACTCCTTGG
Display recognized sequences in FASTA format