text2genome

About us

Related Links

Press Coverage

PubMed: 19707466    PubMedCentral: PMC2727902

Allium compounds, dipropyl and dimethyl thiosulfinates as antiproliferative and differentiating agents of human acute myeloid leukemia cell lines.

Merhi F, Auger J, Rendu F, Bauvois B
Biologics : targets & therapy, 885 , 2008

Abstract:

Epidemiologic studies support the premise that Allium vegetables may lower the risk of cancers. The beneficial effects appear related to the organosulfur products generated upon processing of Allium. Leukemia cells from patients with acute myeloid leukemia (AML) display high proliferative capacity and have a reduced capacity of undergoing apoptosis and maturation. Whether the sulfur-containing molecules thiosulfinates (TS), diallyl TS (All(2)TS), dipropyl TS (Pr(2)TS) and dimethyl TS (Me(2)TS), are able to exert chemopreventative activity against AML is presently unknown. The present study was an evaluation of proliferation, cytotoxicity, differentiation and secretion of AML cell lines (U937, NB4, HL-60, MonoMac-6) in response to treatment with these TS and their related sulfides (diallylsulfide, diallyl disulfide, dipropyl disulfide, dimethyl disulfide). As assessed by flow cytometry, ELISA, gelatin zymogaphy and RT-PCR, we showed that Pr(2)TS and Me(2)TS, but not All(2)TS and sulfides, 1) inhibited cell proliferation in dose- and time-dependent manner and this process was neither due to cytotoxicity nor apoptosis, 2) induced macrophage maturation, and 3) inhibited the levels of secreted MMP-9 (protein and activity) and TNF-alpha protein, without altering mRNA levels. By establishing for the first time that Pr(2)TS and Me(2)TS affect proliferation, differentiation and secretion of leukemic cell lines, this study provides the opportunity to explore the potential efficiency of these molecules in AML.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:2526/FUT4
EntrezGene:308/ANXA5
EntrezGene:31/ACACA
EntrezGene:3684/ITGAM
EntrezGene:4318/MMP9
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7422/VEGFA
EntrezGene:960/CD44

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
VEGFA ENSG00000112715 1,2
TNF ENSG00000204490 3,4
TNF ENSG00000206439 3,4
TNF ENSG00000223952 3,4
TNF ENSG00000228849 3,4
TNF ENSG00000230108 3,4
TNF ENSG00000232810 3,4
TNF ENSG00000228321 4,3
B2M ENSG00000166710 5,6

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
3, 4 HSCHR6_MHC_MANN:31583002-31584502
3, 4 HSCHR6_MHC_COX:31530927-31532427
3, 4 HSCHR6_MHC_DBB:31525659-31527159
3, 4 chr6:31543515-31545015
1, 2 chr6:43745265-43746271
6 chr15:45007757-45007777
3, 4 HSCHR6_MHC_MCF:31619824-31621324
3, 4 HSCHR6_MHC_SSTO:31533458-31534958
3, 4 HSCHR6_MHC_QBL:31533756-31535258

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2727902.pdf TCCAATAGGTGATGTTGTCGT
1 PMC2727902.pdf ACATCTTCCAGGAGTACCCTGATGAG
2 PMC2727902.pdf GCATTCACATTTGTTGTGCTGT
3 PMC2727902.pdf ACCATGAGCACTGAAAGCAT
4 PMC2727902.pdf AGATGAGGTACAGGCCCTCT
5 PMC2727902.pdf CATCCAGCGTACTCCAAAGA
6 PMC2727902.pdf GACAAGTCTGAATGCTCCAC
Display recognized sequences in FASTA format