text2genome

About us

Related Links

Press Coverage

PubMed: 20214788    PubMedCentral: PMC2841123

The AP-1 repressor protein, JDP2, potentiates hepatocellular carcinoma in mice.

Bitton-Worms K, Pikarsky E, Aronheim A
Molecular cancer, 54 , 2010

Abstract:

BACKGROUND: The AP-1 transcription factor plays a major role in cell proliferation, apoptosis, differentiation and developmental processes. AP-1 proteins are primarily considered to be oncogenic. Gene disruption studies placed c-Jun as an oncogene at the early stage of a mouse model of hepatocellular carcinoma. Mice lacking c-Jun display reduced number and size of hepatic tumors attributed to elevated p53 expression and increased apoptosis. This suggests that c-Jun inhibition may serve as a therapeutic target for liver cancer. The c-Jun dimerization protein 2, JDP2 is an AP-1 repressor protein that potently inhibits AP-1 transcription. On the other hand, the JDP2 locus was found at a recurring viral integration site in T-cell lymphoma. We sought to examine the potential of JDP2 to inhibit c-Jun/AP-1 oncogenic activity in mice. Towards this end, we generated a tetracycline inducible transgenic mouse expressing JDP2 specifically in the liver. We used diethylnitrosamine (DEN) injection to initiate liver cancer in mice and assessed the extent of liver cancer in JDP2-transgenic and wild type control mice by biochemical and molecular biology techniques. RESULTS: JDP2-transgenic mice display normal liver function. JDP2-transgenic mice displayed potentiation of liver cancer, higher mortality and increased number and size of tumors. The expression of JDP2 at the promotion stage was found to be the most critical for enhancing liver cancer severity. CONCLUSIONS: This study suggests that JDP2 expression may play a critical role in liver cancer development by potentiating the compensatory proliferative response and increased inflammation in the DEN liver cancer model.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:81703/Jdp2

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Jdp2 ENSMUSG00000034271 0,1,29,30
Tnf ENSMUSG00000024401 4,5
Jund ENSMUSG00000071076 8,9
Il1a ENSMUSG00000027399 10,11
Myd88 ENSMUSG00000032508 12,13
Cdkn1a ENSMUSG00000023067 14,15
Mdm2 ENSMUSG00000020184 16,17
Pmaip1 ENSMUSG00000024521 18,19
Trp53 ENSMUSG00000059552 20,21
Ddit3 ENSMUSG00000025408 22,23
Il6 ENSMUSG00000025746 24,25
Jun ENSMUSG00000052684 26,27
Fosl2 ENSMUSG00000029135 31,32
Ccnd1 ENSMUSG00000070348 33,34
B2m ENSMUSG00000060802 37,38

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
6 chr1:56839020-56839041
14, 15 chr17:29235484-29235590
32 chr5:32449320-32449341
28 chr8:87502279-87502299
37, 38 chr2:121973498-121976670
16, 17 chr10:117133476-117139302
6 chr17:39984748-39984769
26, 27 chr4:94717838-94717940
6 chr2:26976806-26976827
24, 25 chr5:30345939-30346015
33, 34 chr7:152123977-152125553
19 chr18:66620592-66620612
12, 13 chr9:119247202-119247306
10, 11 chr2:129130499-129130562
20, 21 chr11:69403312-69404238
0, 1, 30 chr12:86949114-86979908
8, 9 chr8:73223147-73223294

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2841123.pdf atgatgcctgggcagatccca
1 PMC2841123.pdf tcacttcttgtccagctgctcc
2 PMC2841123.pdf gctgcttaatgaggtcgcaatcg
3 PMC2841123.pdf gccccacagcgctgagtgcat
4 PMC2841123.pdf ccagaccctcacactcagatca
5 PMC2841123.pdf cacttggtggtttgctacgac
6 PMC2841123.pdf tagagggacaagtggcgttca
7 PMC2841123.pdf cccggacatctaagggcat
8 PMC2841123.pdf ggcgggattgaaaccaggg
9 PMC2841123.pdf agcccgttggactggatga
10 PMC2841123.pdf gcaccttacacctaccagagt
11 PMC2841123.pdf aaacttctgcctgacgagctt
12 PMC2841123.pdf aggacaaacgccggaactttt
13 PMC2841123.pdf gccgatagtctgtctgttctagt
14 PMC2841123.pdf cgagaacggtggaactttgac
15 PMC2841123.pdf cagggctcaggtagaccttg
16 PMC2841123.pdf aggagatgtgtttggagtccc
17 PMC2841123.pdf ctcagcgatgtgccagagtc
18 PMC2841123.pdf gcagagctaccacctgagttc
19 PMC2841123.pdf cttttgcgacttcccaggca
20 PMC2841123.pdf ctctcccccgcaaaagaaaa
21 PMC2841123.pdf ctcctctgtagcatgggcatc
22 PMC2841123.pdf gggccaacagaggtcacac
23 PMC2841123.pdf cttcatgcgttgcttccca
24 PMC2841123.pdf tagtccttcctaccccaatttcc
25 PMC2841123.pdf ttggtccttagccactccttcc
26 PMC2841123.pdf ccttctacgacgatgccctc
27 PMC2841123.pdf ggttcaaggtcatgctctgttt
28 PMC2841123.pdf tcacgacgactcttacgcag
29 PMC2841123.pdf ctcactcttcacgggttgg
30 PMC2841123.pdf gctgaaatacgctgacatc
31 PMC2841123.pdf ccagcagaagttccgggtag
32 PMC2841123.pdf gtagggatgtgagcgtggata
33 PMC2841123.pdf gcgtaccctgacaccaatctc
34 PMC2841123.pdf ctcctcttcgcacttctgctc
35 PMC2841123.pdf gaggattttgctaacctgacc
36 PMC2841123.pdf ttgacggtaactgactccc
37 PMC2841123.pdf ttctggtgcttgtctcactga
38 PMC2841123.pdf cagtatgttcggcttcccattc
Display recognized sequences in FASTA format