text2genome

About us

Related Links

Press Coverage

PubMed: 11574694    PubMedCentral: PMC60252

DNA microarrays with stem-loop DNA probes: preparation and applications.

Broude NE, Woodward K, Cavallo R, Cantor CR, Englert D
Nucleic acids research, e92 , 2001

Abstract:

We have developed DNA microarrays containing stem-loop DNA probes with short single-stranded overhangs immobilized on a Packard HydroGel chip, a 3-dimensional porous gel substrate. Microarrays were fabricated by immobilizing self-complementary single-stranded oligonucleotides, which adopt a partially duplex structure upon denaturing and re-annealing. Hybridization of single-stranded DNA targets to such arrays is enhanced by contiguous stacking interactions with stem-loop probes and is highly sequence specific. Subsequent enzymatic ligation of the targets to the probes followed by stringent washing further enhances the mismatched base discrimination. We demonstrate here that these microarrays provide excellent specificity with signal-to-background ratios of from 10- to 300-fold. In a comparative study, we demonstrated that HydroGel arrays display 10-30 times higher hybridization signals than some solid surface DNA microarrays. Using Sanger sequencing reactions, we have also developed a method for preparing nested 3'-deletion sets from a target and evaluated the use of stem-loop DNA arrays for detecting p53 mutations in the deletion set. The stem-loop DNA array format is simple, robust and flexible in design, thus it is potentially useful in various DNA diagnostic tests.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 2,3,4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3 chr17:7576916-7577054

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC60252.pdf CGCCGTCCTATTACGAGCTA
1 PMC60252.pdf TGGGGTGCTCCCTTAGTTCGCTTTGCTCGGCAGTTATAGCCAGCAGCAGTTAGCTCG
2 PMC60252.pdf CTCACCACGAGCTGCCCCCAAGGGAGCACTAAGCGAGCACTGCCCAA
3 PMC60252.pdf CTCACCACGAGCTGCACCCAAGGGAGCACTAAGCGAGCACTGCCCAA
4 PMC60252.pdf CTCACCACGAGCTGCCCCCAAGGGAGCACTAAGCGAGCACTGCACAA
5 PMC60252.pdf CTCACCACGAGCTGCACCCAAGGGAGCACTAAGCGAGCACTGCACAA
6 PMC60252.pdf TTTTTTATAGCCAGCAGCAGTT
Display recognized sequences in FASTA format