text2genome

About us

Related Links

Press Coverage

PubMed: 19079608    PubMedCentral: PMC2597179

Modulation of macrophage activation state protects tissue from necrosis during critical limb ischemia in thrombospondin-1-deficient mice.

Bréchot N, Gomez E, Bignon M, Khallou-Laschet J, Dussiot M, Cazes A, Alanio-Bréchot C, Durand M, Philippe J, Silvestre JS, Van Rooijen N, Corvol P, Nicoletti A, Chazaud B, Germain S
PloS one, , 2008

Abstract:

BACKGROUND: Macrophages, key regulators of healing/regeneration processes, strongly infiltrate ischemic tissues from patients suffering from critical limb ischemia (CLI). However pro-inflammatory markers correlate with disease progression and risk of amputation, suggesting that modulating macrophage activation state might be beneficial. We previously reported that thrombospondin-1 (TSP-1) is highly expressed in ischemic tissues during CLI in humans. TSP-1 is a matricellular protein that displays well-known angiostatic properties in cancer, and regulates inflammation in vivo and macrophages properties in vitro. We therefore sought to investigate its function in a mouse model of CLI. METHODS AND FINDINGS: Using a genetic model of tsp-1(-/-) mice subjected to femoral artery excision, we report that tsp-1(-/-) mice were clinically and histologically protected from necrosis compared to controls. Tissue protection was associated with increased postischemic angiogenesis and muscle regeneration. We next showed that macrophages present in ischemic tissues exhibited distinct phenotypes in tsp-1(-/-) and wt mice. A strong reduction of necrotic myofibers phagocytosis was observed in tsp-1(-/-) mice. We next demonstrated that phagocytosis of muscle cell debris is a potent pro-inflammatory signal for macrophages in vitro. Consistently with these findings, macrophages that infiltrated ischemic tissues exhibited a reduced postischemic pro-inflammatory activation state in tsp-1(-/-) mice, characterized by a reduced Ly-6C expression and a less pro-inflammatory cytokine expression profile. Finally, we showed that monocyte depletion reversed clinical and histological protection from necrosis observed in tsp-1(-/-) mice, thereby demonstrating that macrophages mediated tissue protection in these mice. CONCLUSION: This study defines targeting postischemic macrophage activation state as a new potential therapeutic approach to protect tissues from necrosis and promote tissue repair during CLI. Furthermore, our data suggest that phagocytosis plays a crucial role in promoting a deleterious intra-tissular pro-inflammatory macrophage activation state during critical injuries. Finally, our results describe TSP-1 as a new relevant physiological target during critical leg ischemia.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:21825/Thbs1
Genes found in fulltext (GNAT)
EntrezGene:12759/Clu
EntrezGene:12772/Ccr2
EntrezGene:1435/CSF1
EntrezGene:16153/Il10
EntrezGene:17311/Kitl
EntrezGene:19264/Ptprc
EntrezGene:21825/Thbs1
EntrezGene:21926/Tnf
EntrezGene:22083/Ctr9
EntrezGene:2213/FCGR2B
EntrezGene:2215/FCGR3B
EntrezGene:23266/LPHN2
EntrezGene:3569/IL6
EntrezGene:3586/IL10
EntrezGene:3684/ITGAM
EntrezGene:383/ARG1
EntrezGene:4843/NOS2
EntrezGene:5465/PPARA
EntrezGene:5788/PTPRC
EntrezGene:7057/THBS1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7422/VEGFA
EntrezGene:7462/LAT2
EntrezGene:94221/Gopc

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1
Il1b ENSMUSG00000027398 2,3
Il10 ENSMUSG00000016529 4,5
Pparg ENSMUSG00000000440 6,7
Tgfb1 ENSMUSG00000002603 8,9
Nos2 ENSMUSG00000020826 10,11
Arg1 ENSMUSG00000019987 12,13

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3 chr2:129191717-129193097
4, 5 chr1:132917550-132919121
8, 9 chr7:26477503-26479323
12, 13 chr10:24636629-24640472
0, 1 chr17:35337305-35338729
6, 7 chr6:115413127-115422978
10, 11 chr11:78735852-78743272

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2597179.pdf AAAGATGGGGGGCTTCCAGAACTC
1 PMC2597179.pdf TGAGATAGCAAATCGGCTGACGG
2 PMC2597179.pdf TGACGTTCCCATTAGACAACTG
3 PMC2597179.pdf CCGTCTTTCATTACACAGGACA
4 PMC2597179.pdf ACCAGCTGGACAACATACTGC
5 PMC2597179.pdf TCACTCTTCACCTGCTCCACT
6 PMC2597179.pdf AGGCCGAGAAGGAGAAGCTGTTG
7 PMC2597179.pdf TGGCCACCTCTTTGCTCTGCTC
8 PMC2597179.pdf TGCGCTTGCAGAGATTAAAA
9 PMC2597179.pdf CGTCAAAAGACAGCCACTCA
10 PMC2597179.pdf GAAGAAAACCCCTTGTGCTG
11 PMC2597179.pdf TCCAGGGATTCTGGAACATT
12 PMC2597179.pdf CAGAAGAATGGAAGAGTCAG
13 PMC2597179.pdf CAGATATGCAGGGAGTCACC
Display recognized sequences in FASTA format