text2genome

About us

Related Links

Press Coverage

PubMed: 16192667    PubMedCentral: PMC1526481

Melatonin reduces inflammatory injury through inhibiting NF-kappaB activation in rats with colitis.

Li JH, Yu JP, Yu HG, Xu XM, Yu LL, Liu J, Luo HS
Mediators of inflammation, 185 , 2005

Abstract:

Proinflammatory mediators are important in the pathogenesis of IBD, which are regulated by activation of NF-kappaB. The aim of this study was to investigate whether melatonin reduces inflammatory injury and inhibits proinflammatory molecule and NF-kappaB in rats with colitis. Rat colitis model was established by TNBS enema. NF-kappaB p65, TNF-alpha, ICAM-1, and IkappaBalpha in colon tissue were examined by immunohistochemistry, EMSA, RT-PCR, and Western blot analysis. Expression of proinflammatory molecule and activation of NF-kappaB were upregulated and IkappaB level decreased in rats with colitis. Melatonin reduces colonic inflammatory injury through downregulating proinflammatory molecule mediated by NF-kappaB inhibition and blockade of IkappaBalpha degradation.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Rattus norvegicus
Homo sapiens
Mus musculus
Genes found in fulltext (GNAT)
EntrezGene:213/ALB
EntrezGene:23114/NFASC
EntrezGene:24835/TNFA_RAT
EntrezGene:25464/ICAM1_RAT
EntrezGene:3383/ICAM1
EntrezGene:3558/IL2
EntrezGene:3815/KIT
EntrezGene:4353/MPO
EntrezGene:5966/REL
EntrezGene:5970/RELA
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNFA_RAT ENSRNOG00000000837 1,2
ICAM1_RAT ENSRNOG00000020679 3,4
ACTB_RAT ENSRNOG00000034254 5,6

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1 chr20:3661157-3661181
3, 4 chr8:20043025-20048491
5, 6 chr12:12048087-12049209

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1526481.pdf AGTTGAGGGGACTTTCCCAGGC
1 PMC1526481.pdf CATGATCCGAGATGTGGAACTGGC
2 PMC1526481.pdf CTGGCTCAGCCACTCCAGC
3 PMC1526481.pdf AGGTATCCATCCATCCCACA
4 PMC1526481.pdf AGTGTCTCATTCCCACGGA
5 PMC1526481.pdf ATGGATGACGATATCGCTG
6 PMC1526481.pdf ATGAGGTAGTCTGTCAGGT
Display recognized sequences in FASTA format