text2genome

About us

Related Links

Press Coverage

PubMed: 19451265    PubMedCentral: PMC2715059

Zinc transporter Znt5/Slc30a5 is required for the mast cell-mediated delayed-type allergic reaction but not the immediate-type reaction.

Nishida K, Hasegawa A, Nakae S, Oboki K, Saito H, Yamasaki S, Hirano T
The Journal of experimental medicine, 1351 , 2009

Abstract:

Zinc (Zn) is an essential nutrient and its deficiency causes immunodeficiency. However, it remains unknown how Zn homeostasis is regulated in mast cells and if Zn transporters are involved in allergic reactions. We show that Znt5/Slc30a5 is required for contact hypersensitivity and mast cell-mediated delayed-type allergic response but not for immediate passive cutaneous anaphylaxis. In mast cells from Znt5(-/-) mice, Fc epsilon receptor I (Fc epsilonRI)-induced cytokine production was diminished, but degranulation was intact. Znt5 was involved in Fc epsilonRI-induced translocation of protein kinase C (PKC) to the plasma membrane and the nuclear translocation of nuclear factor kappaB. In addition, the Zn finger-like motif of PKC was required for its plasma membrane translocation and binding to diacylglycerol. Thus, Znt5 is selectively required for the mast cell-mediated delayed-type allergic response, and it is a novel player in mast cell activation.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:16590/Kit
EntrezGene:69048/Slc30a5
Species found in fulltext (Linnaeus)
Mus musculus
Homo sapiens
Lateolabrax japonicus
Mus sp.
Oryctolagus cuniculus
Trypanosoma cruzi
Danio rerio
Rattus norvegicus
Genes found in fulltext (GNAT)
EntrezGene:10892/MALT1
EntrezGene:11019/LIAS
EntrezGene:1613/DAPK3
EntrezGene:16187/Il3
EntrezGene:16193/Il6
EntrezGene:21926/Tnf
EntrezGene:23114/NFASC
EntrezGene:25800/SLC39A6
EntrezGene:2597/GAPDH
EntrezGene:27040/LAT
EntrezGene:3339/HSPG2
EntrezGene:3562/IL3
EntrezGene:3569/IL6
EntrezGene:3815/KIT
EntrezGene:3897/L1CAM
EntrezGene:4153/MBL2
EntrezGene:5595/MAPK3
EntrezGene:5599/MAPK8
EntrezGene:57120/GOPC
EntrezGene:6366/CCL21
EntrezGene:64924/SLC30A5
EntrezGene:69048/Slc30a5
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7922/SLC39A7
EntrezGene:7922/SLC39A4
EntrezGene:7922/SLC39A7
EntrezGene:7922/SLC39A7
EntrezGene:7922/SLC39A7
EntrezGene:7922/SLC39A7
EntrezGene:8915/BCL10
EntrezGene:9531/BAG3

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Il6 ENSMUSG00000025746 0,1
Tnf ENSMUSG00000024401 2,3
Gapdh ENSMUSG00000057666 4,5
Hprt1 ENSMUSG00000025630 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
4, 5 chr3:121933580-121933817
4, 5 chr11:20235482-20235719
4, 5 chr4:57384292-57384529
4, 5 chr6:86235183-86235419
2, 3 chr17:35337378-35337847
4, 5 chr5:96291029-96291266
4, 5 chr8:60029395-60029632
4, 5 chrX:77439657-77439894
4, 5 chr2:43374384-43374621
4, 5 NT_166349:396718-396955
4, 5 chr8:47340492-47340729
4, 5 chr14:12113913-12114150
4, 5 chr15:8878618-8878854
4, 5 chr6:83824840-83825077
4, 5 chr5:106292187-106292424
4, 5 chr3:139312639-139312876
4, 5 chr11:63126279-63126516
4, 5 chr4:91518826-91519063
4, 5 chr8:95240293-95240530
6, 7 chrX:50352266-50355306
4, 5 chr8:77929884-77930121
0, 1 chr5:30340004-30341416
4, 5 chr3:69370823-69371060
9 chr2:122510928-122510957
4, 5 chr4:83751101-83751338
4, 5 chr7:59002363-59002600
4, 5 chr2:28789595-28789832
4, 5 chr15:12504940-12505177
4, 5 chr11:26686929-26687166
4, 5 chr3:142625871-142626108
4, 5 chrX:85817858-85818095

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2715059.pdf GAGGATACCACTCCCAACAGACC
1 PMC2715059.pdf AAGTGCATCATCGTTGTTCATACA
2 PMC2715059.pdf CATCTTCTCAAAATTCGAGTGACAA
3 PMC2715059.pdf TGGGAGTAGACAAGGTACAACCC
4 PMC2715059.pdf TTCACCACCATGGAGAAGGCCG
5 PMC2715059.pdf GGCATGGACTGTGGTCATGA
6 PMC2715059.pdf CCTCCCATCTCCTTCATGACA
7 PMC2715059.pdf GATTAGCGATGATGAACCAGGTT
8 PMC2715059.S10.pdf GAAGGCAGTCTCCCTGCTGTATGCAGACTATGGACAAGCAGTTTTCCCTCTGGCTTTCCACCCACTGCCATAGTTCACATGCCTGATCGATCCTCCGGAACTGGGGTGCTAGAAGTCCGAAAGAACTCCTCCCTCGTTGGAACCCTGGGGGATGTATTTCAGCTCAGCCAGATGCAGTTAACGCAGGCAGGCAGTATCACTCAGCGCTGTCAATGCCTGAAGA
9 PMC2715059.S10.pdf GCGACCAGACAAGGACTTCATCATTCCAAGGGGCCCTGGCACACCCGCCTCAATGTGATAGCAATTTGCACAAGTTCTGATCACTGTCCATGTGCATGGTGTGAACGAATCCAGTCGTCCTTGAATGCGTTTGGCTTAAGATCCAACTCAGGCCCTTTGGAACACTTGGGATCATCTTGCTGGTGAGGTGCTCATGTCCTCATCCTTTGACCGCCCTTGAGAGTG
Display recognized sequences in FASTA format