text2genome

About us

Related Links

Press Coverage

PubMed: 20111721    PubMedCentral: PMC2811745

The protective antibodies induced by a novel epitope of human TNF-alpha could suppress the development of collagen-induced arthritis.

Dong J, Gao Y, Liu Y, Shi J, Feng J, Li Z, Pan H, Xue Y, Liu C, Shen B, Shao N, Yang G
PloS one, , 2010

Abstract:

Tumor necrosis factor alpha (TNF-alpha) is a major inflammatory mediator that exhibits actions leading to tissue destruction and hampering recovery from damage. At present, two antibodies against human TNF-alpha (hTNF-alpha) are available, which are widely used for the clinic treatment of certain inflammatory diseases. This work was undertaken to identify a novel functional epitope of hTNF-alpha. We performed screening peptide library against anti-hTNF-alpha antibodies, ELISA and competitive ELISA to obtain the epitope of hTNF-alpha. The key residues of the epitope were identified by means of combinatorial alanine scanning and site-specific mutagenesis. The N terminus (80-91 aa) of hTNF-alpha proved to be a novel epitope (YG1). The two amino acids of YG1, proline and valine, were identified as the key residues, which were important for hTNF-alpha biological function. Furthermore, the function of the epitope was addressed on an animal model of collagen-induced arthritis (CIA). CIA could be suppressed in an animal model by prevaccination with the derivative peptides of YG1. The antibodies of YG1 could also inhibit the cytotoxicity of hTNF-alpha. These results demonstrate that YG1 is a novel epitope associated with the biological function of hTNF-alpha and the antibodies against YG1 can inhibit the development of CIA in animal model, so it would be a potential target of new therapeutic antibodies.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Homo sapiens
Mus musculus
Rattus norvegicus
Bos taurus
Mus sp.
Escherichia coli
Oryctolagus cuniculus
Armoracia rusticana
Capra hircus
Hylobates sp.
Genes found in fulltext (GNAT)
EntrezGene:21926/Tnf
EntrezGene:24835/TNFA_RAT
EntrezGene:26227/PHGDH
EntrezGene:3439/IFNA1
EntrezGene:4703/NEB
EntrezGene:51428/DDX41
EntrezGene:6868/ADAM17
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7133/TNFRSF1B
EntrezGene:7462/LAT2

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000204490 1,2,3,4,5,6
TNF ENSG00000206439 1,2,3,4,5,6
TNF ENSG00000223952 1,2,3,4,5,6
TNF ENSG00000228321 1,2,3,4,5,6
TNF ENSG00000228849 1,2,3,4,5,6
TNF ENSG00000228978 1,2,3,4,5,7
TNF ENSG00000232810 1,2,3,4,5,6
TNF ENSG00000230108 5,6,1,2,3,4

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1, 2, 3, 4, 5, 6, 7 HSCHR6_MHC_APD:31555869-31555912
1, 2, 3, 4, 5, 6, 7 chr6:31544548-31544591
1, 2, 3, 4, 5, 6, 7 HSCHR6_MHC_COX:31531960-31532003
1, 2, 3, 4, 5, 6, 7 HSCHR6_MHC_MANN:31584035-31584078

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2811745.pdf CATGTTTCGGCCGAAAGCACAGCACAGAGAGCAGAGAGAGTGAGAATAGAAAGGTACCCGGG
1 PMC2811745.pdf GGGAATTCCATATGGTACGTTCTTCTTCTCGTACTCCGAGTGACAAGCCTGTAGCCCATGTTGTAG
2 PMC2811745.pdf GGGAATTCCATATGGTACGTTCTTCTTCTgcTACTCCGAGTGACAAGCCTGTAGCCCATGTTGTAGTATGGGAATTCCATATGGTACGTTCTTCTTCTCGTgCTCCGAGTGACAAata
3 PMC2811745.pdf GCCTGTAGCCCATGTTGTAG
4 PMC2811745.pdf GGGAATTCCATATGGTACGTTCTTCTTCTCGTACTgCGAGTGACAAGCCTGTAGCCCATGTTGTAG
5 PMC2811745.pdf GGGAATTCCATATGGTACGTTCTTCTTCTCGTACTCCGAGTGcCAAGCCTGTAGCCCATGTTGTAG
6 PMC2811745.pdf GGGAATTCCATATGGTACGTTCTTCTTCTCGTACTCCGAGTGACAAGgCTGTAGCCCATGTTGTAG
7 PMC2811745.pdf GGGAATTCCATATGGTACGTTCTTCTTCTCGTACTCCGAGTGACAAGCCTGcAGCCCATGTTGTAG
8 PMC2811745.pdf CCGCTCGAGTCACAGGGCAATGATCCCAA
Display recognized sequences in FASTA format