text2genome

About us

Related Links

Press Coverage

PubMed: 18980698    PubMedCentral: PMC2584659

Spontaneous transformation of human granulosa cell tumours into an aggressive phenotype: a metastasis model cell line.

Imai M, Muraki M, Takamatsu K, Saito H, Seiki M, Takahashi Y
BMC cancer, 319 , 2008

Abstract:

BACKGROUND: Granulosa cell tumours (GCTs) are frequently seen in menopausal women and are relatively indolent. Although the physiological properties of normal granulosa cells have been studied extensively, little is known about the molecular mechanism of GCT progression. Here, we characterise the unique behavioural properties of a granulosa tumour cell line, KGN cells, for the molecular analysis of GCT progression. METHODS: Population doubling was carried out to examine the proliferation capacity of KGN cells. Moreover, the invasive capacity of these cells was determined using the in vitro invasion assay. The expression level of tumour markers in KGN cells at different passages was then determined by Western blot analysis. Finally, the growth and metastasis of KGN cells injected subcutaneously (s.c.) into nude mice was observed 3 months after injection. RESULTS: During in vitro culture, the advanced passage KGN cells grew 2-fold faster than the early passage cells, as determined by the population doubling assay. Moreover, we found that the advanced passage cells were 2-fold more invasive than the early passage cells. The expression pattern of tumour markers, such as p53, osteopontin, BAX and BAG-1, supported the notion that with passage, KGN cells became more aggressive. Strikingly, KGN cells at both early and advanced passages metastasized to the bowel when injected s.c. into nude mice. In addition, more tumour nodules were formed when the advanced passage cells were implanted. CONCLUSION: KGN cells cultured in vitro acquire an aggressive phenotype, which was confirmed by the analysis of cellular activities and the expression of biomarkers. Interestingly, KGN cells injected s.c. are metastatic with nodule formation occurring mostly in the bowel. Thus, this cell line is a good model for analysing GCT progression and the mechanism of metastasis in vivo.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:12017/Bag1
EntrezGene:12028/Bax
EntrezGene:1588/CYP19A1
EntrezGene:1950/EGF
EntrezGene:22059/Trp53
EntrezGene:2597/GAPDH
EntrezGene:573/BAG1
EntrezGene:581/BAX
EntrezGene:6696/SPP1
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 0,1
GAPDH ENSG00000111640 2,3

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1 chr17:7578204-7578230
2, 3 chr12:63149532-63149982
2, 3 chr10:93426567-93427015
2, 3 chr6:166478302-166478757
2, 3 chr12:6646749-6647305

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2584659.pdf CAGCCAAGTCTGTGACTTGCACGTAC
1 PMC2584659.pdf CTATGTCGAAAAGTGTTTCTGTCATC
2 PMC2584659.pdf ACCACAGTCCATGCCATCAC
3 PMC2584659.pdf TCCACCACCCTGTTGCTGTA
Display recognized sequences in FASTA format