text2genome

About us

Related Links

Press Coverage

PubMed: 20072622    PubMedCentral: PMC2800179

Degraded carrageenan causing colitis in rats induces TNF secretion and ICAM-1 upregulation in monocytes through NF-kappaB activation.

Benard C, Cultrone A, Michel C, Rosales C, Segain JP, Lahaye M, Galmiche JP, Cherbut C, Blottière HM
PloS one, , 2010

Abstract:

Carrageenan (CGN) is a high molecular weight sulphated polysaccharide derived from red seaweeds. In rodents, its degraded forms (dCGN) can induce intestinal inflammation associated with macrophage recruitment and activation. The aim of this study was: 1) to analyze the size-dependent effects of dCGN on colon inflammation in vivo, and 2) to correlate these effects with monocyte/macrophage proliferation, cytokine production and expression of various cell surface antigens including ICAM-1 adhesion molecule. Peripheral blood monocytes (PBM) and THP-1 monocytic cells were cultured in the presence of either 10 or 40 kDa, dCGN. The 40 kDa, but not the 10 kDa dCGN, induced colitis in in vivo. Degraded CGN inhibited THP-1 cell proliferation in vitro, arresting the cells in G1 phase. In addition, dCGN increased ICAM-1 expression in both PBM and THP-1 cells with a major effect seen after 40 kDa dCGN exposure. Also, dCGN stimulated monocyte aggregation in vitro that was prevented by incubation with anti-ICAM-1 antibody. Finally, dCGN stimulated TNF-alpha expression and secretion by both PBM and THP-1 cells. All these effects were linked to NF-kappaB activation. These data strongly suggest that the degraded forms of CGN have a pronounced effect on monocytes, characteristic of an inflammatory phenotype.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1019/CDK4
EntrezGene:1026/CDKN1A
EntrezGene:113246/C12orf57
EntrezGene:23114/NFASC
EntrezGene:24835/TNFA_RAT
EntrezGene:3383/ICAM1
EntrezGene:3576/IL8
EntrezGene:4353/MPO
EntrezGene:55571/C2orf29
EntrezGene:5687/PSMA6
EntrezGene:7099/TLR4
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:929/CD14
EntrezGene:965/CD58

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
ACTB ENSG00000075624 0,1
TNF ENSG00000204490 2,3
TNF ENSG00000206439 2,3
TNF ENSG00000223952 2,3
TNF ENSG00000228321 2,3
TNF ENSG00000228849 2,3
TNF ENSG00000230108 2,3
TNF ENSG00000232810 2,3
ICAM1 ENSG00000090339 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1 chr15:34665813-34665832
1 chr2:131415363-131415382
2, 3 HSCHR6_MHC_MCF:31620878-31621509
2, 3 HSCHR6_MHC_SSTO:31534512-31535143
2, 3 HSCHR6_MHC_DBB:31526713-31527344
1 chr14:19585838-19585857
2, 3 HSCHR6_MHC_APD:31555890-31556521
1 chr2:132384752-132384771
4, 5 chr19:10395822-10396117
2, 3 HSCHR6_MHC_COX:31531981-31532612
0 chr7:5568247-5568266
1 chr1:229567313-229567332
2, 3 chr6:31544569-31545200
1 chr2:130831884-130831903
1 chr5:79595564-79595583
2, 3 HSCHR6_MHC_MANN:31584056-31584687
1 chr2:132022169-132022188
2, 3 HSCHR6_MHC_QBL:31534812-31535443
1 chr14:19987778-19987797

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2800179.pdf GGCATCGTGATGGACTCCG
1 PMC2800179.pdf GCTGGAAGGTGGACAGCGA
2 PMC2800179.pdf AAGCCTGTAGCCCATGTTGT
3 PMC2800179.pdf CAGATAGATGGGCTCATACC
4 PMC2800179.pdf GTAGCAGCCGCAGTCATAATGG
5 PMC2800179.pdf TGCTGTTGTATCTGACTGAGG
Display recognized sequences in FASTA format