text2genome

About us

Related Links

Press Coverage

PubMed: 16117829    PubMedCentral: PMC1224858

Establishment of a doxycycline-regulated cell line with inducible, doubly-stable expression of the wild-type p53 gene from p53-deleted hepatocellular carcinoma cells.

Chi TY, Chen GG, Ho LK, Lai PB
Cancer cell international, 27 , 2005

Abstract:

p53 is important in the development of hepatocellular carcinoma (HCC) and in therapeutic approaches, but the mechanism whereby it inhibits HCC growth is still unclear. The aim of the present study was to establish a HCC cell system in which p53 levels can be regulated. Full-length wild-type p53 cDNA obtained by PCR was cloned into a retroviral response vector controlled by the tetracycline responsive element (RevTRE-p53). The regulatory vectors RevTet-Off and RevTRE-p53 were transfected into a packaging cell line, PT67. Hep3B cells in which the p53 gene was deleted were infected with RevTet-Off viral particles from the PT67. Three G418-resistant cell clones with high luciferase expression and low background were infected with RevTRE-p53. By screening dozens of RevTRE-p53-infected clones with hygromycin we identified the one with the highest expression of p53 and the lowest background after doxycycline treatment. The results showed that p53 expression in this cell clone could be simply turned on or off by removing or adding doxycycline. Furthermore, it was found that the level of p53 protein was negatively and sensitively related to the doxycycline concentration. In conclusion, we have established a HCC cell line in which p53 expression can be switched on or off and regulated in a dose- and time-dependent manner.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:2678/GGT1
EntrezGene:29123/ANKRD11
EntrezGene:31/ACACA
EntrezGene:3815/KIT
EntrezGene:6899/TBX1

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 0,1,3
B2M ENSG00000166710 8,9

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 2 chr17:7590731-7591130
8 chr15:45007823-45007843

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1224858.pdf TTAAGCTTTTTGCGTTCGGGCTGGGAGC
1 PMC1224858.pdf CGATCGATATGGTGGCATGAACCTGTGG
2 PMC1224858.pdf AAGCTTTTTGCGTTCGGGCTGGGAGC
3 PMC1224858.pdf ATCGATATGGTGGCATGAACCTGTGG
4 PMC1224858.pdf TCCTGTCATCTCACCTTGCTCC
5 PMC1224858.pdf GCAATATCACGGGTAGCCAACGa
6 PMC1224858.pdf TACATGTGTTAACAGTTCCTGCA
7 PMC1224858.pdf TTCTGACAACGATCGGAGGA
8 PMC1224858.pdf ACCCCCACTGAAAAAGATGA
9 PMC1224858.pdf ATCTTCAAACCTCCATGATG
Display recognized sequences in FASTA format