text2genome

About us

Related Links

Press Coverage

PubMed: 20186333    PubMedCentral: PMC2826410

Evidence of genetic instability in tumors and normal nearby tissues.

Geraci G, D'Elia I, del Gaudio R, Di Giaimo R
PloS one, , 2010

Abstract:

BACKGROUND: Comprehensive analyses have recently been performed on many human cancer tissues, leading to the identification of a number of mutated genes but providing no information on the variety of mutations present in each of them. This information is of interest to understand the possible origin of gene mutations that cause tumors. METHODOLOGY/PRINCIPAL FINDINGS: We have analyzed the sequence heterogeneity of the transcripts of the human HPRT and G6PD single copy genes that are not considered tumor markers. Analyses have been performed on different colon cancers and on the nearby histologically normal tissues of two male patients. Several copies of each cDNA, which were produced by cloning the RT-PCR-amplified fragments of the specific mRNA, have been sequenced. Similar analyses have been performed on blood samples of two ostensibly healthy males as reference controls. The sequence heterogeneity of the HPRT and G6PD genes was also determined on DNA from tumor tissues. The employed analytical approach revealed the presence of low-frequency mutations not detectable by other procedures. The results show that genetic heterogeneity is detectable in HPRT and G6PD transcripts in both tumors and nearby healthy tissues of the two studied colon tumors. Similar frequencies of mutations are observed in patient genomic DNA, indicating that mutations have a somatic origin. HPRT transcripts show genetic heterogeneity also in healthy individuals, in agreement with previous results on human T-cells, while G6PD transcript heterogeneity is a characteristic of the patient tissues. Interestingly, data on TP53 show little, if any, heterogeneity in the same tissues. CONCLUSIONS/SIGNIFICANCE: These findings show that genetic heterogeneity is a peculiarity not only of cancer cells but also of the normal tissue where a tumor arises.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
G6PD ENSG00000160211 1,11
TP53 ENSG00000141510 13,14

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
3, 6, 7, 8, 9, 10 chrX:133607690-133632460
0, 1, 11 chrX:153763396-153774302
13, 14 chr17:7576903-7578503

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2826410.pdf CAAGACAGACATGCTTGTGG
1 PMC2826410.pdf GGACTCGTGAATGTTCTTGG
2 PMC2826410.pdf CGAACTCCTGAGCTCAGGCAG
3 PMC2826410.pdf GTTCTGGTCCCTACAGAGTCC
4 PMC2826410.pdf TGTATTGCCCAGGTTGGTG
5 PMC2826410.pdf CAAGTCCCAACAGCAATTCC
6 PMC2826410.pdf CAGTAATGGCCGATTAGGAC
7 PMC2826410.pdf ACCTAGACTGCTTCCAAGGG
8 PMC2826410.pdf GCTGTCATTGATCCTGCACC
9 PMC2826410.pdf CTCTGCCATGCTATTCAGGAC
10 PMC2826410.pdf GCTTATATCCAACACTTCGTGGG
11 PMC2826410.pdf CGATGCCTTCCATCAGTCG
12 PMC2826410.pdf GGACTCGTGAATGTTCTTGG
13 PMC2826410.pdf GTGCAGCTGTGGGTTGATTCC
14 PMC2826410.pdf GGAGCTGGTGTTGTTGGGCAG
Display recognized sequences in FASTA format