text2genome

About us

Related Links

Press Coverage

PubMed: 18715114    PubMedCentral: PMC2517615

Two faces of chondroitin sulfate proteoglycan in spinal cord repair: a role in microglia/macrophage activation.

Rolls A, Shechter R, London A, Segev Y, Jacob-Hirsch J, Amariglio N, Rechavi G, Schwartz M
PLoS medicine, , 2008

Abstract:

BACKGROUND: Chondroitin sulfate proteoglycan (CSPG) is a major component of the glial scar. It is considered to be a major obstacle for central nervous system (CNS) recovery after injury, especially in light of its well-known activity in limiting axonal growth. Therefore, its degradation has become a key therapeutic goal in the field of CNS regeneration. Yet, the abundant de novo synthesis of CSPG in response to CNS injury is puzzling. This apparent dichotomy led us to hypothesize that CSPG plays a beneficial role in the repair process, which might have been previously overlooked because of nonoptimal regulation of its levels. This hypothesis is tested in the present study. METHODS AND FINDINGS: We inflicted spinal cord injury in adult mice and examined the effects of CSPG on the recovery process. We used xyloside to inhibit CSPG formation at different time points after the injury and analyzed the phenotype acquired by the microglia/macrophages in the lesion site. To distinguish between the resident microglia and infiltrating monocytes, we used chimeric mice whose bone marrow-derived myeloid cells expressed GFP. We found that CSPG plays a key role during the acute recovery stage after spinal cord injury in mice. Inhibition of CSPG synthesis immediately after injury impaired functional motor recovery and increased tissue loss. Using the chimeric mice we found that the immediate inhibition of CSPG production caused a dramatic effect on the spatial organization of the infiltrating myeloid cells around the lesion site, decreased insulin-like growth factor 1 (IGF-1) production by microglia/macrophages, and increased tumor necrosis factor alpha (TNF-alpha) levels. In contrast, delayed inhibition, allowing CSPG synthesis during the first 2 d following injury, with subsequent inhibition, improved recovery. Using in vitro studies, we showed that CSPG directly activated microglia/macrophages via the CD44 receptor and modulated neurotrophic factor secretion by these cells. CONCLUSIONS: Our results show that CSPG plays a pivotal role in the repair of injured spinal cord and in the recovery of motor function during the acute phase after the injury; CSPG spatially and temporally controls activity of infiltrating blood-borne monocytes and resident microglia. The distinction made in this study between the beneficial role of CSPG during the acute stage and its deleterious effect at later stages emphasizes the need to retain the endogenous potential of this molecule in repair by controlling its levels at different stages of post-injury repair.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:12505/Cd44
EntrezGene:13051/Cx3cr1
EntrezGene:16000/Igf1
EntrezGene:21926/Tnf

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr17:35336693-35336907

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2517615.pdf GGGACAGTGACCTGGACTGT
1 PMC2517615.pdf AGGCTGTGCATTGCACCTCA
2 PMC2517615.pdf TGGATGCTCTTCAGTTCGTGGTCTTGGGCATGTCAGTGTG
3 PMC2517615.pdf AGCGAGCTCGAGCATGGCGAGCCCTCATCGTCGACTCGAGATCTCCGAGTCA
4 PMC2517615.pdf GCTGACACTTTTGAGCACAAATCCACTATCTTCCCC
5 PMC2517615.pdf CTTCGCTCGTTTCCTTCAACAGAGTGAGGAGGGGAACCAT
6 PMC2517615.pdf TGAATCAGCTGGCTTTTGTGGTGGATAGCTCGGTGGTGTT
7 PMC2517615.pdf TAAAACGCAGCTCAGTAACAGTCCGTGGAATCCTGTGGCATCCATGAAAC
Display recognized sequences in FASTA format