text2genome

About us

Related Links

Press Coverage

PubMed: 19633712    PubMedCentral: PMC2711328

Resolving cell population heterogeneity: real-time PCR for simultaneous multiplexed gene detection in multiple single-cell samples.

Diercks A, Kostner H, Ozinsky A
PloS one, , 2009

Abstract:

Decoding the complexity of multicellular organisms requires analytical procedures to overcome the limitations of averaged measurements of cell populations, which obscure inherent cell-cell heterogeneity and restrict the ability to distinguish between the responses of individual cells within a sample. For example, defining the timing, magnitude and the coordination of cytokine responses in single cells is critical for understanding the development of effective immunity. While approaches to measure gene expression from single cells have been reported, the absolute performance of these techniques has been difficult to assess, which likely has limited their wider application. We describe a straightforward method for simultaneously measuring the expression of multiple genes in a multitude of single-cell samples using flow cytometry, parallel cDNA synthesis, and quantification by real-time PCR. We thoroughly assess the performance of the technique using mRNA and DNA standards and cell samples, and demonstrate a detection sensitivity of approximately 30 mRNA molecules per cell, and a fractional error of 15%. Using this method, we expose unexpected heterogeneity in the expression of 5 immune-related genes in sets of single macrophages activated by different microbial stimuli. Further, our analyses reveal that the expression of one 'pro-inflammatory' cytokine is not predictive of the expression of another 'pro-inflammatory' cytokine within the same cell. These findings demonstrate that single-cell approaches are essential for studying coordinated gene expression in cell populations, and this generic and easy-to-use quantitative method is applicable in other areas in biology aimed at understanding the regulation of cellular responses.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:11883/Arsa
EntrezGene:12826/Col4a1
EntrezGene:1435/CSF1
EntrezGene:3815/KIT
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 1,2

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
9 chr10:18724295-18724345
6 chr5:92777160-92777204
5 chr12:56591632-56591790
4 chr2:129193758-129193812
1, 2 chr17:35337311-35338707
13 chr7:148450487-148450532
16 chr2:32241012-32241255
15 chr12:82431083-82431441
12 chr11:44226120-44226784

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2711328.S7.doc GCAAAAACGACCCACCAATGGGCCTGGATGGTTCAGGATACACCTGAGCAGTGAAGCCAG
1 PMC2711328.S7.doc TCCAGGCGGTGCCTATGTCACCCCGAAGTTCAGTAGACAGTCAGCCTCTTCTCATTCCTGCTTGTGG
2 PMC2711328.S7.doc CCAGGTTCTCTTCAAGGGACAACACACCGTCAGCCGATTTGCTGCCCCGACTACGTGCTCCTCAC
3 PMC2711328.S7.doc AGCCCCCCTGGTTCAGAAGCTCCTCCTTTCCAGGTCAGTTCATCCAAAAGATACTGAACAAAGGCAAGGC
4 PMC2711328.S7.doc TCAGGCAGGCAGTATCACTCAGGAAGGTCCACGGGAAAGACCTGTGGAGAAGCTGTGGCAGCTACCTG
5 PMC2711328.S7.doc TTGGTGACTTTGGGTGCTGATGAGCGAAACCAGGTCAGGATTAGCCCTGCAATGGCCGGACA
6 PMC2711328.S7.doc GACGGTCCGCTGCAACTGGCTTCCCTATGGCCCTCATTTCACTGGCCCGTCATCGATATGG
7 PMC2711328.S7.doc CTGCAAGAGACTTCCATCCAGTTAAGTAGGGAAGGCCGTGGTT
8 PMC2711328.S7.doc GGGAAAATCGGCATCTCCATTGCTGATTTCTTGGGTTTCGTCGCTCCGACCGGCTCTCGAC
9 PMC2711328.S7.doc GATGGCCTGACTCCCCTACATCCGATTCCTCTGCAGTTCGTACCACCGCATTGTGAGCCACGAAAGCTGGCTGCATGTATTTTGGCCAGGCACGGGACATTGTCTCCAGAAAACAAGGGCTTTTGCA
10 PMC2711328.S7.doc TGACATACCTGATTTGGAAGTGAGATGCATCCCCAATGGGTTCT
11 PMC2711328.S7.doc GTCCAGCATGTGTCAATCACGGCCAAACTGAGGTGGTTTAGGATACCTCCTCTTTTTGGCCACCCTTGC
12 PMC2711328.S7.doc GCTCAGGATCGCTATTACAATTCCTCTTCCTTAATGTCTTCCACTTTTCTTCTGCAGGGAACACATGCCCACTTG
13 PMC2711328.S7.doc TGGCAAGAGAAAATGCTGGGGAGGTCCCCGGCATCACTATCCAAACCCCAAGCCCTCTGCTTT
14 PMC2711328.S7.doc GGCAGCCTGTGAGACCTTTGGCATTGGAAGTGAAGCGTTTC
15 PMC2711328.S7.doc TGGCTTCCATCATGAACAACAGAGGAGGGCTGTGGTGGAGAA
16 PMC2711328.S7.doc ACAAGCAATACTTCAAAATTACCCTGTGGCAAAGCGGGTGAAACAACCAAGGAGCTGTCCCCTGAACT
17 PMC2711328.S7.doc ATGATGCTTCAACATCCAGGCGGCCTTCAGCTCAGCATTCAC
Display recognized sequences in FASTA format