text2genome

About us

Related Links

Press Coverage

PubMed: 2989794    PubMedCentral: PMC321797

Molecular cloning of mouse tumour necrosis factor cDNA and its eukaryotic expression.

Fransen L, Müller R, Marmenout A, Tavernier J, Van der Heyden J, Kawashima E, Chollet A, Tizard R, Van Heuverswyn H, Van Vliet A
Nucleic acids research, 4417 , 1985

Abstract:

Tumour necrosis factor (TNF), released by induced macrophages, causes tumour necrosis in animals and kills preferentially transformed cells in vitro. mRNA induced in the established mouse monocytic PU 5.1.8 cell line by lipopolysaccharide, was converted into double-stranded cDNA and cloned in the pAT153 vector. Recombinant plasmids were screened by plus-minus hybridization and TNF-specific oligonucleotide probes constructed on the basis of partial amino acid sequences of rabbit TNF. A series of TNF specific clones were identified and confirmed by hybrid selection of mouse TNF-specific mRNA. The sequence codes for a 235 amino acids long polypeptide, of which 156 amino acids presumably correspond to the mature product. It can be concluded that mature mouse TNF is a glycosylated dimer. Biologically active TNF was secreted by both Cos-I and CHO-cells transfected with the chimaeric expression vector pSV2d2-mTNF containing the coding region of the mouse TNF cDNA gene.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:21926/Tnf
Genes found in fulltext (GNAT)
EntrezGene:11354/Abpa
EntrezGene:21926/Tnf
EntrezGene:26060/APPL1
EntrezGene:51192/CKLF
EntrezGene:57120/GOPC
EntrezGene:6299/SALL1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 2,3,6

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3, 4, 6 chr17:35336376-35338920

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC321797.txt ATGAAACTACGACAACCAACTGTGTCCGCGCAGGCGCTGCCGAATGGATAATCTTAA
1 PMC321797.txt TGGTACGAACCATTACCTGGCCGGGTCTTCGCAGAAGGTTGACTTTTTCCCTCTCATTAA
2 PMC321797.txt CCTCAGCAACCACAAACTAGCCAGAGGAACAGACTCCACGCATCCTGGAAATAGTCCCAGAAAAGCAGCAGCCAACCAGGCAGGTTCTCTCCCTCACTGGCCCAAGGCGCCACATCTCCCTCCAGAAAAGACACcATGC
3 PMC321797.txt ACAACTACTCAGAACACAAGATGCTGGGACAGTGACCTGGACTGTGGGCCTCTCATGCACCACCATCAAGGACTCAATGGCTCCGAATTCACTGGAGCCTGATCCATTCCTAGTCAAAGGGAGAGTCGTC
4 PMC321797.txt CAGGCCTCTACCTTCAGACCTTCCAGACTCTCCCTGAGGTCAATGCACAGCCTCCTCACAGAGCCAGCCCCCTTTCTATACATAT
5 PMC321797.txt AATGTAATGAAGGCCGGTTCCTGAGGACCCAGTGTC
6 PMC321797.txt TATCTCCCTTTCTTAATAACGCTCATTTGTGACCAGGCTGTCGCTACATCAcTGAACCTCTGCTACCCACGGGAACCCCCCTCAGACGCCAAAACCCCCT
Display recognized sequences in FASTA format