text2genome

About us

Related Links

Press Coverage

PubMed: 1371351    PubMedCentral: PMC310425

Detection of point mutations in human DNA by analysis of RNA conformation polymorphism(s).

Danenberg PV, Horikoshi T, Volkenandt M, Danenberg K, Lenz HJ, Shea LC, Dicker AP, Simoneau A, Jones PA, Bertino JR
Nucleic acids research, 573 , 1992

Abstract:

RNA molecules were found to separate into numerous metastable conformational forms upon non-denaturing gel electrophoresis. The equilibration of the conformations was accelerated by heating or mild denaturing conditions. Single-base substitutions in the sequence of the RNAs caused changes in the conformational patterns, including mobility shifts of major and minor conformations, appearance of new conformations and loss of other conformations. This sequence-dependent RNA conformational polymorphism was used to detect point mutations in p53 and, dihydrofolate reductase genes. Sense and anti-sense RNA strands corresponding to the same segment of the p53 gene gave entirely different conformational patterns. To generate the RNA, short regions of the target genes (up to about 250 bp) were amplified by the polymerase chain reaction and the resulting DNA segments transcribed to RNA by T7 RNA polymerase. The method is rapid, simple, amenable to non-radioactive visualization and was successful in several cases when DNA single-strand conformational polymorphism analysis (Orita et al. (1989) Genomics 5, 874-879) failed to detect the point mutation.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1719/DHFRP1
EntrezGene:2317/FLNB
EntrezGene:31/ACACA
EntrezGene:3815/KIT
EntrezGene:7157/TP53
EntrezGene:788/SLC25A20

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 0,1,2,10,11

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1, 10 chr17:7577572-7578452
4, 5 chr5:79945251-79945302
4, 5 chr18:23751052-23751103

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC310425.txt ATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCACTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCT
1 PMC310425.txt ATGGCCATCTACAAGCAGTCA
2 PMC310425.txt AGGGGCCAGACCATCGCTAT
3 PMC310425.txt GGGAGAACATGGGCATCGGCAAGAACG
4 PMC310425.txt TCGATTCTTCTCAGGAATGG
5 PMC310425.txt GGTCTTCTTACCCATAATCACCAG
6 PMC310425.txt GGAATTCCTAGGTTGGCTCTGAC
7 PMC310425.txt GGAATTCGCTTAGTGCTCCCTGG
8 PMC310425.txt GGAATTCAAGTGGCTCCTGAC
9 PMC310425.txt GGGACAAGTGGCTCCTGACCTGGAG
10 PMC310425.txt ACCACCATCCACTACAACTAC
11 PMC310425.txt GGGAACCACCATCCACTACAACTAC
Display recognized sequences in FASTA format