text2genome

About us

Related Links

Press Coverage

PubMed: 17897455    PubMedCentral: PMC2174931

pHUSH: a single vector system for conditional gene expression.

Gray DC, Hoeflich KP, Peng L, Gu Z, Gogineni A, Murray LJ, Eby M, Kljavin N, Seshagiri S, Cole MJ, Davis DP
BMC biotechnology, 61 , 2007

Abstract:

BACKGROUND: Conditional expression vectors have become a valuable research tool to avoid artefacts that may result from traditional gene expression studies. However, most systems require multiple plasmids that must be independently engineered into the target system, resulting in experimental delay and an increased potential for selection of a cell subpopulation that differs significantly from the parental line. We have therefore developed pHUSH, an inducible expression system that allows regulated expression of shRNA, miRNA or cDNA cassettes on a single viral vector. RESULTS: Both Pol II and Pol III promoters have been successfully combined with a second expression cassette containing a codon-optimized tetracycline repressor and selectable marker. We provide examples of how pHUSH has been successfully employed to study the function of target genes in a number of cell types within in vitro and in vivo assays, including conditional gene knockdown in a murine model of brain cancer. CONCLUSION: We have successfully developed and employed a single vector system that enables Doxycycline regulated RNAi or transgene expression in a variety of in vitro and in vivo model systems. These studies demonstrate the broad application potential of pHUSH for conditional genetic engineering in mammalian cells.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Mus musculus
Cucumber mosaic virus
Homo sapiens
Bos taurus
Mus sp.
Genes found in fulltext (GNAT)
EntrezGene:17279/Melk
EntrezGene:22059/Trp53
EntrezGene:4015/LOX
EntrezGene:673/BRAF
EntrezGene:7157/TP53
EntrezGene:7422/VEGFA
EntrezGene:9833/MELK

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Melk ENSMUSG00000035683 0,1
Trp53 ENSMUSG00000059552 2,3

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
4 chr12:10730162-10730189
0, 1 chr4:44373811-44373845
2, 3 chr17:54559999-54560049
4 chr4:132109443-132109470
2, 3 chr11:69404178-69404228

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2174931.pdf GATCCCCCGTGGACTTCGTACAGAAATTCAAGAGATTTCTGTACGAAGTCCACGTTTTTTGGAAA
1 PMC2174931.pdf TTTTCCAAAAAACGTGGACTTCGTACAGAAATCTCTTGAATTTCTGTACGAAGTCCACGGGG
2 PMC2174931.pdf GCATGGGCATCCTTTAACTCTAA
3 PMC2174931.pdf CATTCAGCTCCCGGAACATCTC
4 PMC2174931.pdf CAATACCTCTCCTATTGGAGCAAGGGC
Display recognized sequences in FASTA format