text2genome

About us

Related Links

Press Coverage

PubMed: 20017901    PubMedCentral: PMC2804704

A novel anti-mycobacterial function of mitogen-activated protein kinase phosphatase-1.

Cheung BK, Yim HC, Lee NC, Lau AS
BMC immunology, 64 , 2009

Abstract:

BACKGROUND: Mycobacterium tuberculosis (MTB) is a major cause of morbidity and mortality in the world. To combat against this pathogen, immune cells release cytokines including tumor necrosis factor-alpha (TNF-alpha), which is pivotal in the development of protective granulomas. Our previous results showed that Bacillus Calmette Guerin (BCG), a mycobacterium used as a model to investigate the immune response against MTB, stimulates the induction of TNF-alpha via mitogen-activated protein kinase (MAPK) in human blood monocytes. Since MAPK phosphatase-1 (MKP-1) is known to regulate MAPK activities, we examined whether MKP-1 plays a role in BCG-induced MAPK activation and cytokine expression. RESULTS: Primary human blood monocytes were treated with BCG and assayed for MKP-1 expression. Our results demonstrated that following exposure to BCG, there was an increase in the expression of MKP-1. Additionally, the induction of MKP-1 was regulated by p38 MAPK and extracellular signal-regulated kinase 1 and 2 (ERK1/2). Surprisingly, when MKP-1 expression was blocked by its specific siRNA, there was a significant decrease in the levels of phospho-MAPK (p38 MAPK and ERK1/2) and TNF-alpha inducible by BCG. CONCLUSIONS: Since TNF-alpha is pivotal in granuloma formation, the results indicated an unexpected positive function of MKP-1 against mycobacterial infection as opposed to its usual phosphatase activity.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:16193/Il6
EntrezGene:1843/DUSP1
EntrezGene:1844/DUSP2
EntrezGene:19252/Dusp1
EntrezGene:21926/Tnf
EntrezGene:3569/IL6
EntrezGene:3586/IL10
EntrezGene:5594/MAPK1
EntrezGene:5595/MAPK3
EntrezGene:5599/MAPK8
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
GAPDH ENSG00000111640 1,0
DUSP1 ENSG00000120129 3,6,7,8,2
TNF ENSG00000204490 4,5
TNF ENSG00000206439 4,5
TNF ENSG00000223952 4,5
TNF ENSG00000228321 4,5
TNF ENSG00000228849 4,5
TNF ENSG00000230108 4,5
TNF ENSG00000232810 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3, 6, 7 chr5:172196035-172197596
0, 1 chr6:166478302-166478757
4, 5 chr6:31543593-31545096
4, 5 HSCHR6_MHC_SSTO:31533536-31535039
0, 1 chr12:6646749-6647305
4, 5 HSCHR6_MHC_MCF:31619902-31621405
4, 5 HSCHR6_MHC_COX:31531005-31532508
4, 5 HSCHR6_MHC_QBL:31533834-31535339
0, 1 chr12:63149532-63149982
4, 5 HSCHR6_MHC_DBB:31525737-31527240
4, 5 HSCHR6_MHC_MANN:31583080-31584583
0, 1 chr10:93426567-93427015

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2804704.pdf ACCACAGTCCATGCCATCAC
1 PMC2804704.pdf TCCACCACCCTGTTGCTGTA
2 PMC2804704.pdf GCTGTGCAGCAAACAGTCGA
3 PMC2804704.pdf CGATTAGTCCTCATAAGGTA
4 PMC2804704.pdf GGCTCCAGGCGGTGCTTGTTC
5 PMC2804704.pdf AGACGGCGATGCGGCTGATG
6 PMC2804704.pdf AAACGCTTCGTATCCTCCTTTGAGG
7 PMC2804704.pdf TTATGCCCAAGGCATCCAGCATGTC
8 PMC2804704.pdf TGATGGAGTCTATGAAGTCAATGGC
Display recognized sequences in FASTA format