text2genome

About us

Related Links

Press Coverage

PubMed: 11574695    PubMedCentral: PMC60253

Quantitative detection of single nucleotide polymorphisms for a pooled sample by a bioluminometric assay coupled with modified primer extension reactions (BAMPER).

Zhou G, Kamahori M, Okano K, Chuan G, Harada K, Kambara H
Nucleic acids research, e93 , 2001

Abstract:

A new method for SNP analysis based on the detection of pyrophosphate (PPi) is demonstrated, which is capable of detecting small allele frequency differences between two DNA pools for genetic association studies other than SNP typing. The method is based on specific primer extension reactions coupled with PPi detection. As the specificity of the primer-directed extension is not enough for quantitative SNP analysis, artificial mismatched bases are introduced into the 3'-terminal regions of the specific primers as a way of improving the switching characteristics of the primer extension reactions. The best position in the primer for such artificial mismatched bases is the third position from the primer 3'-terminus. Contamination with endogenous PPi, which produces a large background signal level in SNP analysis, was removed using PPase to degrade the PPi during the sample preparation process. It is possible to accurately and quantitatively analyze SNPs using a set of primers that correspond to the wild-type and mutant DNA segments. The termini of these primers are at the mutation positions. Various types of SNPs were successfully analyzed. It was possible to very accurately determine SNPs with frequencies as low 0.02. It is very reproducible and the allele frequency difference can be determined. It is accurate enough to detect meaningful genetic differences among pooled DNA samples. The method is sensitive enough to detect 14 amol ssM13 DNA. The proposed method seems very promising in terms of realizing a cost-effective, large-scale human genetic testing system.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:124583/CANT1
EntrezGene:3815/KIT
EntrezGene:5464/PPA1
EntrezGene:6741/SSB
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 0,1,2

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1, 2, 3, 4, 5 chr17:7577002-7577203

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC60253.pdf CTTTCTTGCGGAGATTCTCTTCCTCTGTGCGCCGGTCTCTCCCAGGACAGGCACAAACACGCACCTCAAA
1 PMC60253.pdf GCTGTTCCGTCCCAGTAGATTACCA
2 PMC60253.pdf AACAGCTTTGAGGTGCGTGTT
3 PMC60253.pdf GGTCTCTCCCAGGACAGGCTC
4 PMC60253.pdf tgtcctgcttgcttacctcgcttagt
5 PMC60253.pdf acctgatttccttactgcctcttgc
6 PMC60253.pdf aattctgaaaagtagctTaTGgttctgcagcaccttctAcTCcaaatacatctcccaggTtTCgagaaggtgtctgcgggTgCTcttgagagactcataatCgTCgaaacagtctttggtgtTaTCctgatcccaaagttggtCgCGttggtgtagatgagggaCaTCcaacggcagcttcttccGcCTggctgaggcagggtcagGcAGcactgggagcattgaggGtCTagtgccgacctgcgccaTtCGaacagctttgaggtgcgtgAtATaggtgcgtgtttgtgcctgAcACtgtgcctgtcctgggagagTcTCgcctgtcctgggagagaccgCcAG
Display recognized sequences in FASTA format