text2genome

About us

Related Links

Press Coverage

PubMed: 1579447    PubMedCentral: PMC312235

Mammalian p53 can function as a transcription factor in yeast.

Schärer E, Iggo R
Nucleic acids research, 1539 , 1992

Abstract:

p53 has previously been shown to contain a transactivation domain using GAL4 fusion proteins and to bind specifically to a 33 base pair DNA sequence in immunoprecipitation assays. We show here that mammalian p53 expressed in S. cerevisiae is able to activate transcription of a reporter gene placed under the control of a CYC1 hybrid promoter containing the 33 base pair p53-binding sequence. The activation is dependent on the orientation and number of copies of the binding site. Three p53 mutants commonly found in human tumours, 175H, 248W and 273H, are unable to activate transcription. A fourth human p53 mutant, 285K, is temperature-sensitive for transcriptional activation. Murine p53 activates transcription from the same sequence. The murine 135V mutant, which is temperature-sensitive for mammalian cell transformation, is also temperature-sensitive for transcriptional activation. There is a much better correlation between mutation and transcriptional competence than between mutation and the structure of p53 determined with conformation-sensitive antibodies. We have therefore developed a simple transcription assay for p53 mutation in which yeast are transfected with p53 PCR products and mutation is scored on X-gal plates.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:22059/Trp53
EntrezGene:3960/LGALS4
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 2,3

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0 chr3:169019055-169019085
3 chr17:7572888-7572913

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC312235.txt CCCCGGATCCACTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACGCATG
1 PMC312235.txt TCGACCTTGCCTGGACTTGCCTGGCCTTGCCTTTCGA
2 PMC312235.txt TGGATTGGCAGCCAGACTGCCTTCC
3 PMC312235.txt GTGGGAGGCTGTCAGTGGGGAACAA
Display recognized sequences in FASTA format