text2genome

About us

Related Links

Press Coverage

PubMed: 18464921    PubMedCentral: PMC2366083

Mycoplasma genitalium lipoproteins induce human monocytic cell expression of proinflammatory cytokines and apoptosis by activating nuclear factor kappaB.

Wu Y, Qiu H, Zeng Y, You X, Deng Z, Yu M, Zhu C
Mediators of inflammation, , 2008

Abstract:

This study was designed to investigate the molecular mechanisms responsible for the induction of proinflammatory cytokines gene expression and apoptosis in human monocytic cell line THP-1 stimulated by lipoproteins (LPs) prepared from Mycoplasma genitalium. Cultured cells were stimulated with M. genitalium LP to analyze the production of proinflammatory cytokines and expression of their mRNA by ELISA and RT-PCR, respectively. Cell apoptosis was also detected by Annexin V-FITC-propidium iodide (PI) staining and acridine orange (AO)-ethidium bromide (EB) staining. The DNA-binding activity of nuclear factor-kappaB (NF-kappaB) was assessed by electrophoretic mobility shift assay (EMSA). Results showed that LP stimulated THP-1 cells to produce tumor necrosis factor-alpha (TNF-alpha), interleukin-1beta (IL-1beta), and IL-6 in a dose-dependent manner. The mRNA levels were also upregulated in response to LP stimulation. LPs were also found to increase the DNA-binding activity of NF-kappaB, a possible mechanism for the induction of cytokine mRNA expression and the cell apoptosis. These effects were abrogated by PDTC, an inhibitor of NF-kappaB. Our results indicate that M. genitalium-derived LP may be an important etiological factor of certain diseases due to the ability of LP to produce proinflammatory cytokines and induction of apoptosis, which is probably mediated through the activation of NF-kappaB.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Mycoplasma genitalium
Homo sapiens
Mycoplasma fermentans
Bos taurus
Avian myeloblastosis virus
Mus musculus
Mycoplasma pneumoniae
Mycoplasma salivarium
Mycoplasma hominis
Ureaplasma urealyticum
Genes found in fulltext (GNAT)
EntrezGene:14123/Fbrs
EntrezGene:16193/Il6
EntrezGene:21898/Tlr4
EntrezGene:21926/Tnf
EntrezGene:308/ANXA5
EntrezGene:3569/IL6
EntrezGene:581/BAX
EntrezGene:598/BCL2L1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:788/SLC25A20
EntrezGene:8626/TP63
EntrezGene:9337/CNOT8

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
ACTB ENSG00000075624 1,0
TNF ENSG00000204490 3,4
TNF ENSG00000206439 3,4
TNF ENSG00000223952 3,4
TNF ENSG00000228321 3,4
TNF ENSG00000228849 3,4
TNF ENSG00000230108 3,4
TNF ENSG00000232810 3,4

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
4 chr6:31545091-31545111
4 HSCHR6_MHC_COX:31532503-31532523
4 HSCHR6_MHC_APD:31556412-31556432
4 HSCHR6_MHC_DBB:31527235-31527255
4 HSCHR6_MHC_MANN:31584578-31584598
4 HSCHR6_MHC_QBL:31535334-31535354
4 HSCHR6_MHC_SSTO:31535034-31535054
4 HSCHR6_MHC_MCF:31621400-31621420
0, 1 chr7:5567916-5568921
2 chr2:113593183-113593202

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2366083.pdf CTGGGACGACATGGAGAAAA
1 PMC2366083.pdf AAGGAAGGCTGGAAGAGTGC
2 PMC2366083.pdf TATTACAGTGGCAATGAGG
3 PMC2366083.pdf CAGAGGGAAGAGTTCCCCAG
4 PMC2366083.pdf CCTTGGTCTGGTAGGAGACG
5 PMC2366083.pdf CGAGCTCTGAAACAAAGGAT
6 PMC2366083.pdf AGTTGAGGGGACTTTCCCAGGC
Display recognized sequences in FASTA format