text2genome

About us

Related Links

Press Coverage

PubMed: 20454616    PubMedCentral: PMC2862737

Role of PAF receptor in proinflammatory cytokine expression in the dorsal root ganglion and tactile allodynia in a rodent model of neuropathic pain.

Hasegawa S, Kohro Y, Shiratori M, Ishii S, Shimizu T, Tsuda M, Inoue K
PloS one, , 2010

Abstract:

BACKGROUND: Neuropathic pain is a highly debilitating chronic pain following damage to peripheral sensory neurons and is often resistant to all treatments currently available, including opioids. We have previously shown that peripheral nerve injury induces activation of cytosolic phospholipase A(2) (cPLA(2)) in injured dorsal root ganglion (DRG) neurons that contribute to tactile allodynia, a hallmark of neuropathic pain. However, lipid mediators downstream of cPLA(2) activation to produce tactile allodynia remain to be determined. PRINCIPAL FINDINGS: Here we provide evidence that platelet-activating factor (PAF) is a potential candidate. Pharmacological blockade of PAF receptors (PAFRs) reduced the development and expression of tactile allodynia following nerve injury. The expression of PAFR mRNA was increased in the DRG ipsilateral to nerve injury, which was seen mainly in macrophages. Furthermore, mice lacking PAFRs showed a reduction of nerve injury-induced tactile allodynia and, interestingly, a marked suppression of upregulation of tumor necrosis factor alpha (TNFalpha) and interleukin-1beta (IL-1beta) expression in the injured DRG, crucial proinflammatory cytokines involved in pain hypersensitivity. Conversely, a single injection of PAF near the DRG of naïve rats caused a decrease in the paw withdrawal threshold to mechanical stimulation in a dose-dependent manner and an increase in the expression of mRNAs for TNFalpha and IL-1beta, both of which were inhibited by pretreatment with a PAFR antagonist. CONCLUSIONS: Our results indicate that the PAF/PAFR system has an important role in production of TNFalpha and IL-1beta in the DRG and tactile allodynia following peripheral nerve injury and suggest that blocking PAFRs may be a viable therapeutic strategy for treating neuropathic pain.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:19204/Ptafr

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
IL1B_RAT ENSRNOG00000004649 1,2,3,6,7,8
TNFA_RAT ENSRNOG00000000837 4,5,12
PTAFR_RAT ENSRNOG00000013231 9,10,11

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
5, 12 chr20:3662460-3662550
9, 10, 11 chr5:152568657-152568771
3, 6, 7, 8 chr3:116965030-116967179

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2862737.pdf TCCTGGTATGAGATAGCAAATCGG
1 PMC2862737.pdf TGCAGCTGGAGAGTGTGGATCCCAA
2 PMC2862737.pdf GAAAGACGGCACACCCACC
3 PMC2862737.pdf AGACAAACCGCTTTTCCATCTTC
4 PMC2862737.pdf GACCCTCACACTCAGATCATCTTCT
5 PMC2862737.pdf GGTACAGCCCATCTGCTGGTA
6 PMC2862737.pdf TCTCCACCTCAATGGACAGAACATAAGCCA
7 PMC2862737.pdf AAATGCCTCGTGCTGTCTGA
8 PMC2862737.pdf GTCGTTGCTTGTCTCTCCTTGTAC
9 PMC2862737.pdf ATCTCACCGTGGCGGACCTGCTCT
10 PMC2862737.pdf CCCGTCCAAGAAACTGAATGAG
11 PMC2862737.pdf TCGCCCTCGTTGGAGTAATAGA
12 PMC2862737.pdf TACGTGCTCCTCACCCACACCGTCA
Display recognized sequences in FASTA format