text2genome

About us

Related Links

Press Coverage

PubMed: 17725831    PubMedCentral: PMC2020488

Short-term oleoyl-estrone treatment affects capacity to manage lipids in rat adipose tissue.

Salas A, NoƩ V, Ciudad CJ, Romero MM, Remesar X, Esteve M
BMC genomics, 292 , 2007

Abstract:

BACKGROUND: Short-term OE (oleoyl-estrone) treatment causes significant decreases in rat weight mainly due to adipose tissue loss. The aim of this work was to determine if OE treatment affects the expression of genes that regulate lipid metabolism in white adipose tissue. RESULTS: Gene expression in adipose tissue from female treated rats (48 hours) was analysed by hybridization to cDNA arrays and levels of specific mRNAs were determined by real-time PCR. Treatment with OE decreased the expression of 232 genes and up-regulated 75 other genes in mesenteric white adipose tissue. The use of real-time PCR validate that, in mesenteric white adipose tissue, mRNA levels for Lipoprotein Lipase (LPL) were decreased by 52%, those of Fatty Acid Synthase (FAS) by 95%, those of Hormone Sensible Lipase (HSL) by 32%, those of Acetyl CoA Carboxylase (ACC) by 92%, those of Carnitine Palmitoyltransferase 1b (CPT1b) by 45%, and those of Fatty Acid Transport Protein 1 (FATP1) and Adipocyte Fatty Acid Binding Protein (FABP4) by 52% and 49%, respectively. Conversely, Tumour Necrosis Factor (TNFalpha) values showed overexpression (198%). CONCLUSION: Short-term treatment with OE affects adipose tissue capacity to extract fatty acids from lipoproteins and to deal with fatty acid transport and metabolism.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:10273/STUB1
EntrezGene:1375/CPT1B
EntrezGene:2167/FABP4
EntrezGene:2194/FASN
EntrezGene:25756/CPT1B_RAT
EntrezGene:26457/Slc27a1
EntrezGene:31/ACACA
EntrezGene:3290/HSD11B1
EntrezGene:355/FAS
EntrezGene:376497/SLC27A1
EntrezGene:3815/KIT
EntrezGene:3991/LIPE
EntrezGene:4023/LPL
EntrezGene:6236/RRAD
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNFA_RAT ENSRNOG00000000837 2,3
FABP4_RAT ENSRNOG00000010805 5,6
S27A1_RAT ENSRNOG00000018170 9,10

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
9, 10 chr16:18784062-18784250
2 chr20:3661841-3661862
5, 6 chr2:93536160-93538667

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2020488.pdf CTTGGGTGCCGATTACAACC
1 PMC2020488.pdf GCCCTCCCGTACACTCACTC
2 PMC2020488.pdf GGCTCCCTCTCATCAGTTCCA
3 PMC2020488.pdf GCTTGGTGGTTTGCTACGA
4 PMC2020488.pdf ACCAGGAAGATGGTGTCCCGCTCTGGGGGAGATGTGCTGGGTCAT
5 PMC2020488.pdf CCTTTGTGGGGACCTGGAAA
6 PMC2020488.pdf TGACCGGATGACGACCAAGT
7 PMC2020488.pdf CCCATAAGACCCCATTGCCTGCTGCCTCAGACACACTCCTG
8 PMC2020488.pdf GTGCTGGAGGTGGCTTTGGTTGCTTGACGGATGTGGTTCC
9 PMC2020488.pdf GTGCGACAGATTGGCGAGTT
10 PMC2020488.pdf GCGTGAGGATACGGCTGTTG
Display recognized sequences in FASTA format