text2genome

About us

Related Links

Press Coverage

PubMed: 20157610    PubMedCentral: PMC2816956

Selenium Inhibits Metastasis of Murine Melanoma Cells through the Induction of Cell Cycle Arrest and Cell Death.

Song H, Hur I, Park HJ, Nam J, Park GB, Kong KH, Hwang YM, Kim YS, Cho DH, Lee WJ, Hur DY
Immune network, 236 , 2009

Abstract:

BACKGROUND: Melanoma is the most fatal form of skin cancer due to its rapid metastasis. Recently, several studies reported that selenium can induce apoptosis in melanoma cells. However, the precise mechanism remains to be elucidated. In this study, we investigated the effect of selenium on cell proliferation in murine melanoma and on tumor growth and metastasis in C57BL/6 mice. METHODS: Cell proliferation was measured by MTT assay in selenium-treated melanoma cells. Cell cycle distribution was analysized by staining DNA with propidum iodide (PI). mRNA and protein expression related to cell cycle arrest was measured by reverse transcription PCR and western blot. Tumor growth and metastasis was measured by in vivo model. RESULTS: Selenium was suppressed the proliferation of melanoma cells in a dose dependent manner. The growth inhibition of melanoma by selenium was associated with an arrest of cell cycle distribution at G0/G1 stage. The mRNA and protein level of CDK2/CDK4 was suppressed by treatment with selenium in a time-dependent manner. In vivo, tumor growth was not suppressed by selenium; however tumor metastasis was suppressed by selenium in mouse model. CONCLUSION: These results suggest that selenium might be a potent agent to inhibit proliferative activity of melanoma cells.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Mus musculus
Homo sapiens
Bos taurus
Mus sp.
Salmonella enterica subsp. enterica serovar Typhimurium
Oryza sativa
Lateolabrax japonicus

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Trp53 ENSMUSG00000059552 0,1
Cdk4 ENSMUSG00000006728 6,7
Actb ENSMUSG00000029580 8,9

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
4 chr10:128138423-128138444
8, 9 chr16:37883309-37883594
7 chr10:126503246-126503266
7 chr6:132412625-132412645
2 chr17:29235498-29235519
0, 1 chr11:69400392-69402240

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2816956.pdf ATGACTGCCATGGAGGAGT
1 PMC2816956.pdf CTCGGGTGGCTCATAAGGTA
2 PMC2816956.pdf CTTTGACTTCGTCACGGAGAC
3 PMC2816956.pdf AGGCAGCGTGAAGGTGTTTGGGG
4 PMC2816956.pdf CACAGCCGTGGATATCTGGAG
5 PMC2816956.pdf TTGCGATAACAGGCTCCGTC
6 PMC2816956.pdf ACGCCTGTGGTGGTTACGCT
7 PMC2816956.pdf CCATCTCTGGCACCACTGAC
8 PMC2816956.pdf AAGAGCTATGAGCTGCCTGA
9 PMC2816956.pdf CAGGAGGAGCAATGATCTTG
Display recognized sequences in FASTA format