text2genome

About us

Related Links

Press Coverage

PubMed: 19436757    PubMedCentral: PMC2678193

IL-6 mediated degeneration of forebrain GABAergic interneurons and cognitive impairment in aged mice through activation of neuronal NADPH oxidase.

Dugan LL, Ali SS, Shekhtman G, Roberts AJ, Lucero J, Quick KL, Behrens MM
PloS one, , 2009

Abstract:

BACKGROUND: Multiple studies have shown that plasma levels of the pro-inflammatory cytokine interleukin-6 (IL-6) are elevated in patients with important and prevalent adverse health conditions, including atherosclerosis, diabetes, obesity, obstructive sleep apnea, hypertension, and frailty. Higher plasma levels of IL-6, in turn, increase the risk of many conditions associated with aging including age-related cognitive decline. However, the mechanisms underlying this association between IL-6 and cognitive vulnerability remain unclear. METHODS AND FINDINGS: We investigated the role of IL-6 in brain aging in young (4 mo) and aged (24 mo) wild-type C57BL6 and genetically-matched IL-6(-/-) mice, and determined that IL-6 was necessary and sufficient for increased neuronal expression of the superoxide-producing immune enzyme, NADPH-oxidase, and this was mediated by non-canonical NFkappaB signaling. Furthermore, superoxide production by NADPH-oxidase was directly responsible for age-related loss of parvalbumin (PV)-expressing GABAergic interneurons, neurons essential for normal information processing, encoding, and retrieval in hippocampus and cortex. Targeted deletion of IL-6 or elimination of superoxide by chronic treatment with a superoxide-dismutase mimetic prevented age-related loss of PV-interneurons and reversed age-related cognitive deficits on three standard tests of spatial learning and recall. CONCLUSIONS: Present results indicate that IL-6 mediates age-related loss of critical PV-expressing GABAergic interneurons through increased neuronal NADPH-oxidase-derived superoxide production, and that rescue of these interneurons preserves cognitive performance in aging mice, suggesting that elevated peripheral IL-6 levels may be directly and mechanistically linked to long-lasting cognitive deficits in even normal older individuals. Further, because PV-interneurons are also selectively affected by commonly used anesthetic agents and drugs, our findings imply that IL-6 levels may predict adverse CNS effects in older patients exposed to these compounds through specific derangements in inhibitory interneurons, and that therapies directed at lowering IL-6 may have cognitive benefits clinically.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:13058/Cybb
EntrezGene:16193/Il6
EntrezGene:66021/NP_076455.1
Genes found in fulltext (GNAT)
EntrezGene:10128/LRPPRC
EntrezGene:13058/Cybb
EntrezGene:1401/CRP
EntrezGene:1535/CYBA
EntrezGene:1536/CYBB
EntrezGene:16193/Il6
EntrezGene:1666/DECR1
EntrezGene:3569/IL6
EntrezGene:3570/IL6R
EntrezGene:3684/ITGAM
EntrezGene:4688/NCF2
EntrezGene:4858/NOVA2
EntrezGene:50490/Nox4
EntrezGene:50507/NOX4
EntrezGene:5199/CFP
EntrezGene:6646/SOAT1
EntrezGene:6647/SOD1
EntrezGene:6648/SOD2
EntrezGene:6649/SOD3
EntrezGene:761/CA3
EntrezGene:9021/SOCS3

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Il6 ENSMUSG00000025746 0,1
Il1b ENSMUSG00000027398 2,3
Tnf ENSMUSG00000024401 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
7 chr3:121933143-121933163
7 chr8:60030049-60030069
7 chr5:28866060-28866080
7 chr8:44285710-44285730
4, 5 chr17:35337378-35337847
7 chr19:25870330-25870350
7 chr5:125916089-125916109
7 chr4:91518389-91518409
7 chr1:147031968-147031988
7 chr14:103769712-103769732
7 chr6:83824403-83824423
7 chr6:94771462-94771482
7 chr12:72947328-72947348
7 chrX:136619049-136619069
7 chr13:20796282-20796302
7 chr7:37020234-37020254
7 chr17:25463587-25463607
7 chr2:28789158-28789178
7 chr9:109732918-109732938
7 chr8:77929447-77929467
7 chr7:79857550-79857570
7 chr11:26687583-26687603
7 chrX:149837664-149837684
7 chr13:49900343-49900363
7 chr7:49380600-49380620
7 chr2:65116432-65116452
7 chrX:77439220-77439240
7 chr11:3852668-3852688
7 chr5:96291683-96291703
7 chr11:37504775-37504795
7 chr15:18094456-18094476
7 chr15:84697697-84697717
7 chr7:107909349-107909369
7 chr10:22512028-22512048
7 chr2:151200732-151200752
7 chr5:13042463-13042483
7 chr3:100218447-100218467
7 chr2:73797756-73797776
7 chr15:75685279-75685299
7 chr6:93087028-93087048
7 chrX:95760494-95760514
7 chr14:49029251-49029271
7 chr2:104132681-104132701
7 chr4:82840847-82840867
7 chrX:21082541-21082561
7 chr6:128152195-128152215
7 chr13:12032759-12032779
7 chr17:61920368-61920388
7 chr2:11330687-11330707
7 chr10:39732628-39732648
7 chr9:75541490-75541510
7 chr8:95239856-95239876
7 chr8:29297248-29297268
7 chr1:12556416-12556436
7 chr1:121055091-121055111
7 chrX:112572533-112572553
7 chrX:136210656-136210676
7 chr6:91379827-91379847
7 chr8:35384936-35384956
7 chr10:44726872-44726892
7 chr1:15258910-15258930
7 chr2:149569846-149569866
7 chrX:148380859-148380879
7 chr2:45665939-45665959
7 chr8:94212298-94212318
7 chr16:50112115-50112135
7 chr1:182257332-182257352
7 chr15:12505594-12505614
7 chr2:146580464-146580484
7 chr8:100089533-100089553
7 chr5:106291750-106291770
7 NT_166349:397372-397392
7 chr5:68960770-68960790
7 chrX:37353989-37354009
7 chr1:13775994-13776014
0, 1 chr5:30341456-30344654
7 chr3:139313293-139313313
7 chr1:188785341-188785361
7 chr9:52972757-52972777
7 chr9:49994178-49994198
7 chr1:102178936-102178956
7 chr13:69485487-69485507
7 chr7:30640689-30640709
7 chr16:32727661-32727681
7 chr19:46748793-46748813
7 chr15:43048726-43048746
7 chr8:13087381-13087401
7 chr7:59003017-59003037
7 chr14:121922921-121922941
7 chr3:142626525-142626545
7 chr8:42694052-42694072
7 chr8:37435680-37435700
7 chrX:11490247-11490267
7 chr15:4836070-4836090
7 chr1:107987550-107987570
7 chr18:9749671-9749691
7 chr7:77636689-77636709
7 chr6:22654365-22654385
7 chr5:142759972-142759992
7 chr15:93027978-93027998
7 chr12:5596453-5596473
7 chr9:83859616-83859636
7 chr17:14847011-14847031
7 chr13:94064655-94064675
7 chr9:37494468-37494488
7 chrX:109774160-109774180
7 chr1:70114569-70114589
7 chr9:51431808-51431828
7 chr10:33528333-33528353
7 chr9:45644042-45644062
7 chr7:96757155-96757175
7 chr4:83751755-83751775
7 chr11:20235045-20235065
7 chr6:125112080-125112100
7 chr3:52417707-52417727
7 chr18:90112767-90112787
7 chr4:57383855-57383875
7 chr14:41371478-41371498
7 chr14:12113476-12113496
7 chr12:82473230-82473250
7 chr4:90036362-90036382
7 chr14:55661558-55661578
7 chr9:113440303-113440323

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2678193.pdf atggatgctaccaaactggat
1 PMC2678193.pdf tgaaggactctggctttgtct
2 PMC2678193.pdf caaccaacaagtgatattctccatg
3 PMC2678193.pdf gatccacactctccagctgca
4 PMC2678193.pdf catcttctcaaaattcgagtgacaa
5 PMC2678193.pdf tgggagtagacaaggtacaaccc
6 PMC2678193.pdf gaacatcatccctgcctctactgg
7 PMC2678193.pdf tccaccaccctgttgctgta
Display recognized sequences in FASTA format