text2genome

About us

Related Links

Press Coverage

PubMed: 15142274    PubMedCentral: PMC416450

CD14 mediates the innate immune responses to arthritopathogenic peptidoglycan-polysaccharide complexes of Gram-positive bacterial cell walls.

Li X, Bradford BU, Dalldorf F, Goyert SM, Stimpson SA, Thurman RG, Makarov SS
Arthritis research & therapy, R273 , 2004

Abstract:

Bacterial infections play an important role in the multifactorial etiology of rheumatoid arthritis. The arthropathic properties of Gram-positive bacteria have been associated with peptidoglycan-polysaccharide complexes (PG-PS), which are major structural components of bacterial cell walls. There is little agreement as to the identity of cellular receptors that mediate innate immune responses to PG-PS. A glycosylphosphatidylinositol-linked cell surface protein, CD14, the lipopolysaccharide receptor, has been proposed as a PG-PS receptor, but contradictory data have been reported. Here, we examined the inflammatory and pathogenic responses to PG-PS in CD14 knockout mice in order to examine the role for CD14 in PG-PS-induced signaling. We found that PG-PS-induced responses in vitro, including transient increase in intracellular calcium, activation of nuclear factor-kappaB, and secretion of the cytokines tumor necrosis factor-alpha and interleukin-6, were all strongly inhibited in CD14 knockout macrophages. In vivo, the incidence and severity of PG-PS induced acute polyarthritis were significantly reduced in CD14 knockout mice as compared with their wild-type counterparts. Consistent with these findings, CD14 knockout mice had significantly inhibited inflammatory cell infiltration and synovial hyperplasia, and reduced expression of inflammatory cytokines in PG-PS arthritic joints. These results support an essential role for CD14 in the innate immune responses to PG-PS and indicate an important role for CD14 in PG-PS induced arthropathy.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:12475/Cd14
Genes found in fulltext (GNAT)
EntrezGene:21926/Tnf
EntrezGene:2597/GAPDH
EntrezGene:31/ACACA
EntrezGene:3569/IL6
EntrezGene:5970/RELA
EntrezGene:7097/TLR2
EntrezGene:7099/TLR4
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7298/TYMS

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr17:35337354-35338637

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC416450.pdf TACTGAACTTCGGGGTGATTGGTCC
1 PMC416450.pdf CAGCCTTGTCCCTTGAAGAGAACC
2 PMC416450.pdf TGAAGGTCGGTGTCAACGGATTTG
3 PMC416450.pdf GTACATCCGTACTCCAGGTGGTG
Display recognized sequences in FASTA format