text2genome

About us

Related Links

Press Coverage

PubMed: 20180981    PubMedCentral: PMC2831902

Moderate doses of conjugated linoleic acid reduce fat gain, maintain insulin sensitivity without impairing inflammatory adipose tissue status in mice fed a high-fat diet.

Parra P, Palou A, Serra F
Nutrition & metabolism, 5 , 2010

Abstract:

ABSTRACT: BACKGROUND: The enrichment of diet with nutrients with potential benefits on body composition is a strategy to combat obesity. Conjugated linoleic acid (CLA) due its beneficial effects on body composition and inflammatory processes becomes an interesting candidate, since the promotion and impairment of obesity is closely linked to a low-grade inflammation state of adipose tissue. Previously we reported the favourable effects of moderate doses of CLA mixture on body composition and inflammatory status of adipose tissue in mice fed a standard-fat diet. In the present study we assessed the potential beneficial effects of CLA mixture (cis-9, trans-11 and trans-10, cis-12, 50:50) in mice fed a high-fat diet. METHODS: Two doses were assayed: 0.15 g (CLA1) and 0.5 g CLA/kg body weight (CLA2) for the first 30 days of the study and then animals received a double amount for another 35 days. RESULTS: The lowest dose (CLA1) had minor effects on body composition, plasma parameters and gene expression. However, a clear reduction in fat accumulation was achieved by CLA2, accompanied by a reduction in leptin, adiponectin and non-esterified fatty acids (NEFA) plasma concentrations. Insulin sensitivity was maintained despite a slight increase in fasting glucose and insulin plasma concentrations. The study of gene expression both in adipocytes and in the stromal vascular fraction (SVF) suggested that CLA may reduce either the infiltration of macrophages in adipose tissue or the induction of expression of pro-inflammatory cytokines. CONCLUSION: In conclusion, the use of moderate doses of an equimolar mix of the two main CLA isomers reduces body fat content, improves plasma lipid profile, maintains insulin sensitivity (despite a moderate degree of hyperinsulinaemia) without the promotion of inflammatory markers in adipose tissue of mice fed a high-fat diet.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Adipoq ENSMUSG00000022878 0,1
Lep ENSMUSG00000059201 2,3
Ccl2 ENSMUSG00000035385 4,5
Emr1 ENSMUSG00000004730 7,6
Il6 ENSMUSG00000025746 8,9
Tnf ENSMUSG00000024401 10,11
Nos2 ENSMUSG00000020826 12,13

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
8, 9 chr5:30340073-30344653
0 chr16:23155290-23155309
14 chr17:39984180-39984200
7 chr17:57600120-57600140
12 chr11:78764595-78764615
2, 3 chr6:29019063-29020896
4, 5 chr11:81849142-81850096
15 chr6:3151523-3151543
11 chr17:35337371-35337393

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2831902.pdf GCTCAGGATGCTACTGTTG
1 PMC2831902.pdf TCTCACCCTTAGGACCAAG
2 PMC2831902.pdf TTGTCACCAGGATCAATGACATTT
3 PMC2831902.pdf GACAAACTCAGAATGGGGTGAAG
4 PMC2831902.pdf GCTCTCTCTTCCTCCACCAC
5 PMC2831902.pdf GCTTCTTTGGGACACCTGCT
6 PMC2831902.pdf TTTCCTCGCCTGCTTCTTC
7 PMC2831902.pdf CCCCGTCTCTGTATTCAACC
8 PMC2831902.pdf TGGGAAATCGTGGAAATGAG
9 PMC2831902.pdf GAAGGACTCTGGCTTTGTCTT
10 PMC2831902.pdf CGTCGTAGCAAACCACCAA
11 PMC2831902.pdf GAGAACCTGGGAGTAGACAAGG
12 PMC2831902.pdf GGCAGCTACTGGGTCAAAGA
13 PMC2831902.pdf TCTGAGGGCTGACACAAGG
14 PMC2831902.pdf CGCGGTTCTATTTTGTTGGT
15 PMC2831902.pdf AGTCGGCATCGTTTATGGTC
Display recognized sequences in FASTA format