text2genome

About us

Related Links

Press Coverage

PubMed: 20157615    PubMedCentral: PMC2816961

Swiprosin-1 Regulates Cytokine Expression of Human Mast Cell Line HMC-1 through Actin Remodeling.

Ramesh TP, Kim YD, Kwon MS, Jun CD, Kim SW
Immune network, 274 , 2009

Abstract:

BACKGROUND: Swiprosin-1 was identified in human CD8+ lymphocytes, mature B cells and non-lymphonoid tissue. We have recently reported that swiprosin-1 is expressed in mast cells and up-regulated in both in vitro and in vivo. METHODS: The expression of cytokines and swiprosin-1 were determined by by real time PCR and conventional PCR. Pharmacological inhibitors were treated to investigate potential mechanism of swiprosin-1 in mast cell activation. Actin content was evaluated by confocal microscopy and flow cytometry. RESULTS: The swiprosin-1 augmented PMA/A23187-induced expression of cytokines and release of histamine. However, knock-down of swiprosin-1 showed only a modest effect on PMA/A23187-induced cytokine expression, suggesting that swiprosin-1 has gain-of-function characteristics. Swiprosin-1 was found in microvilli-like membrane protrusions and highly co-localized with F-actin. Importantly, either disruption of actin by cytochalasin B or inhibition of PI3 kinase, an enzyme involved in actin remodeling, by wortmannin blocked cytokine expression only in swiprosin-1-overexpressing cells. CONCLUSION: These results suggest that swiprosin-1 modulates mast cell activation potentially through actin regulation.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
EFHD2 ENSG00000142634 2,3,4,0
IL3 ENSG00000164399 11,12
IL8 ENSG00000169429 13,14
TNF ENSG00000204490 15,16
TNF ENSG00000206439 15,16
TNF ENSG00000223952 15,16
TNF ENSG00000228321 15,16
TNF ENSG00000228849 15,16
TNF ENSG00000230108 15,16
TNF ENSG00000232810 15,16
GAPDH ENSG00000111640 18,17

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
15, 16 HSCHR6_MHC_QBL:31533834-31535339
20 chr11:1824961-1824982
20 chr1:229568373-229568394
12 chr5:131398454-131398473
20 chr9:6834810-6834831
18 chr1:120039139-120039163
17 chr4:88128254-88128278
20 chr9:103493869-103493890
20 chr2:130832567-130832588
15, 16 HSCHR6_MHC_DBB:31525737-31527240
15, 16 chr6:31543593-31545096
15, 16 HSCHR6_MHC_MANN:31583080-31584583
0, 2, 3, 4 chr1:15736467-15756469
20 chr2:132021484-132021505
20 chr2:132384067-132384088
20 chr22:16256099-16256120
18 chr15:64821544-64821568
18 chr12:6646149-6646173
15, 16 HSCHR6_MHC_SSTO:31533536-31535039
20 chr2:131221139-131221160
20 chr3:180538657-180538678
20 chr14:19988461-19988482
20 chrX:46148185-46148206
17 chrX:46300108-46300132
15, 16 HSCHR6_MHC_COX:31531005-31532508
20 chr15:34666492-34666513
15, 16 HSCHR6_MHC_MCF:31619902-31621405
18 chr12:63149303-63149327
20 chr3:12112091-12112112
13, 14 chr4:74607258-74607725
20 chr22:41470867-41470888
20 chr2:131414678-131414699

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2816961.pdf AAGAATTCTATGGCCACGGACGAGCTGGCCACC
1 PMC2816961.pdf TTTGGATCCCTACTTAAAGGTGGACTGCAGCTC
2 PMC2816961.pdf ATCTTCCGCAAGGCGGCGGCCGGGGAG
3 PMC2816961.pdf GACTGCAGCTCCTTGAAGGCCGCTTTC
4 PMC2816961.pdf CTCGAGGCCACAGTTATGCAA
5 PMC2816961.pdf CGTTATGCAATGTTCCTCGTGTCACTG
6 PMC2816961.pdf GATTCTCACAGGTTCTAAGACCGAAAA
7 PMC2816961.pdf TACAATGCCTCAAGAGCCCCCGGGACC
8 PMC2816961.pdf CCAAAAGTAAAGGGAATTTATATTCCT
9 PMC2816961.pdf GAGGCTCCCGACGAGACTGCCCAGGCG
10 PMC2816961.pdf CCGGAAGCTGAGTTTGCTGTCGAAATC
11 PMC2816961.pdf CTTTGCCTTTGCTGGACTTC
12 PMC2816961.pdf CGAGGCTCAAAGTCGTCTG
13 PMC2816961.pdf GTGCAGTTTTGCCAAGGAGT
14 PMC2816961.pdf CTCTGCACCCAGTTTTCCTT
15 PMC2816961.pdf GGCTCCAGGCGGTGCTTGTTC
16 PMC2816961.pdf AGACGGCGATGCGGCTGATG
17 PMC2816961.pdf CGGAGTCAACGGATTTGGTCGTAT
18 PMC2816961.pdf AGCCTTCTCCATGGTGGTGAAGAC
19 PMC2816961.pdf ATTGAACACGGCATTGTCAC
20 PMC2816961.pdf GTCTCAAACATGATCTGGGTC
Display recognized sequences in FASTA format